Incidental Mutation 'R3738:Lcorl'
ID270227
Institutional Source Beutler Lab
Gene Symbol Lcorl
Ensembl Gene ENSMUSG00000015882
Gene Nameligand dependent nuclear receptor corepressor-like
SynonymsMlr1, A830039H10Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R3738 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location45697181-45857615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45734041 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 323 (N323K)
Ref Sequence ENSEMBL: ENSMUSP00000084408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016026] [ENSMUST00000045586] [ENSMUST00000087164] [ENSMUST00000121573] [ENSMUST00000190036]
Predicted Effect probably benign
Transcript: ENSMUST00000016026
AA Change: N406K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000016026
Gene: ENSMUSG00000015882
AA Change: N406K

DomainStartEndE-ValueType
low complexity region 234 253 N/A INTRINSIC
Pfam:HTH_psq 276 313 5.1e-9 PFAM
Pfam:HTH_psq 525 570 1.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045586
SMART Domains Protein: ENSMUSP00000042677
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 234 253 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000087164
AA Change: N323K

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000084408
Gene: ENSMUSG00000015882
AA Change: N323K

DomainStartEndE-ValueType
low complexity region 151 170 N/A INTRINSIC
Pfam:HTH_psq 193 230 3.4e-7 PFAM
Pfam:HTH_psq 442 487 9.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121573
SMART Domains Protein: ENSMUSP00000112416
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 151 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190036
Meta Mutation Damage Score 0.0689 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that appears to function in spermatogenesis. Polymorphisms in this gene are associated with measures of skeletal frame size and adult height. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,281 L775* probably null Het
Abcb8 A G 5: 24,400,621 S168G probably benign Het
Ankrd11 A G 8: 122,896,715 probably benign Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Atp8b1 A G 18: 64,533,729 probably benign Het
Camk2d A G 3: 126,771,839 D136G probably damaging Het
Capn3 G A 2: 120,485,287 D227N possibly damaging Het
Cwf19l2 A T 9: 3,456,803 H712L probably benign Het
Dlgap3 A G 4: 127,195,606 T332A probably damaging Het
Eml6 C A 11: 29,803,137 V925L probably benign Het
Fbll1 G A 11: 35,797,678 H253Y possibly damaging Het
Fbxw18 T A 9: 109,688,913 Y335F possibly damaging Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gm8251 A G 1: 44,058,866 V1024A probably benign Het
Ifi203 T A 1: 173,929,474 probably benign Het
Insig1 T A 5: 28,071,703 I89N probably damaging Het
Itpkc T A 7: 27,227,604 D295V possibly damaging Het
Jak1 T C 4: 101,191,468 probably benign Het
Kctd9 G A 14: 67,734,288 D157N possibly damaging Het
Kmt2c A C 5: 25,405,383 F242V probably benign Het
Lin54 T C 5: 100,459,806 probably benign Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Myh9 G A 15: 77,766,812 R1612C probably damaging Het
Nr1d2 T A 14: 18,211,804 N433I possibly damaging Het
Olfr1217 T C 2: 89,023,610 Y131C probably damaging Het
Olfr1385 A G 11: 49,495,460 D309G possibly damaging Het
Olfr724 T C 14: 49,960,556 N172S possibly damaging Het
Pld4 T C 12: 112,768,035 I410T probably benign Het
Pnmal2 C T 7: 16,946,596 H502Y probably benign Het
Pramef8 T C 4: 143,416,642 probably benign Het
Rbbp8nl G T 2: 180,281,248 T184K probably benign Het
Saa4 T A 7: 46,729,629 N96Y possibly damaging Het
Serpinb6d T A 13: 33,667,680 V140E probably damaging Het
Ska3 A T 14: 57,811,596 M306K probably benign Het
Slfn4 T C 11: 83,185,311 M1T probably null Het
Sorcs1 T C 19: 50,151,221 I1168V probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
St18 G A 1: 6,855,473 probably null Het
Trim9 T C 12: 70,251,195 T579A probably damaging Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Ube2j1 A T 4: 33,036,723 M16L probably benign Het
Usp42 C T 5: 143,715,439 S943N probably benign Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Vmn2r62 G A 7: 42,787,887 P391L probably benign Het
Zfa-ps T A 10: 52,544,540 noncoding transcript Het
Zfp423 A G 8: 87,781,344 C666R probably damaging Het
Other mutations in Lcorl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Lcorl APN 5 45747295 missense probably damaging 1.00
IGL01611:Lcorl APN 5 45747092 missense probably damaging 1.00
IGL03014:Lcorl UTSW 5 45774029 intron probably benign
R0070:Lcorl UTSW 5 45733701 missense probably damaging 1.00
R0070:Lcorl UTSW 5 45733701 missense probably damaging 1.00
R0499:Lcorl UTSW 5 45734369 missense probably benign 0.00
R1518:Lcorl UTSW 5 45734201 missense possibly damaging 0.94
R1817:Lcorl UTSW 5 45795346 missense probably damaging 1.00
R1977:Lcorl UTSW 5 45775420 missense probably null 0.16
R2171:Lcorl UTSW 5 45747151 missense probably damaging 0.99
R3737:Lcorl UTSW 5 45734041 missense possibly damaging 0.95
R3739:Lcorl UTSW 5 45734041 missense possibly damaging 0.95
R3825:Lcorl UTSW 5 45775387 splice site probably benign
R4035:Lcorl UTSW 5 45734041 missense possibly damaging 0.95
R4199:Lcorl UTSW 5 45733788 missense possibly damaging 0.83
R4583:Lcorl UTSW 5 45733589 nonsense probably null
R4647:Lcorl UTSW 5 45733589 nonsense probably null
R4803:Lcorl UTSW 5 45747281 unclassified probably null
R5524:Lcorl UTSW 5 45775522 critical splice acceptor site probably null
R5524:Lcorl UTSW 5 45775523 critical splice acceptor site probably null
R5526:Lcorl UTSW 5 45733727 missense probably benign
R5533:Lcorl UTSW 5 45733877 missense possibly damaging 0.47
R5772:Lcorl UTSW 5 45795367 splice site probably null
R5927:Lcorl UTSW 5 45725424 intron probably benign
R6175:Lcorl UTSW 5 45776490 missense probably damaging 1.00
R6734:Lcorl UTSW 5 45733497 missense probably damaging 0.98
R6864:Lcorl UTSW 5 45747204 missense probably damaging 1.00
R7078:Lcorl UTSW 5 45747224 missense probably damaging 1.00
R7396:Lcorl UTSW 5 45857459 splice site probably null
R7624:Lcorl UTSW 5 45701965 missense probably benign
X0023:Lcorl UTSW 5 45734012 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGAGTTACAGGCCCAGAAC -3'
(R):5'- GTAAAGAAACTTGTGCTGTGCTG -3'

Sequencing Primer
(F):5'- TACAGGCCCAGAACAGTCTAGTTTG -3'
(R):5'- ACTTGTGCTGTGCTGCAAAAAG -3'
Posted On2015-03-18