Incidental Mutation 'R3738:Pnmal2'
ID270231
Institutional Source Beutler Lab
Gene Symbol Pnmal2
Ensembl Gene ENSMUSG00000070802
Gene NamePNMA-like 2
SynonymsEG434128
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R3738 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location16944682-16948828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 16946596 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 502 (H502Y)
Ref Sequence ENSEMBL: ENSMUSP00000092401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094807]
Predicted Effect probably benign
Transcript: ENSMUST00000094807
AA Change: H502Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092401
Gene: ENSMUSG00000070802
AA Change: H502Y

DomainStartEndE-ValueType
Pfam:PNMA 1 152 4.1e-36 PFAM
low complexity region 172 196 N/A INTRINSIC
internal_repeat_1 239 296 1.86e-6 PROSPERO
SCOP:d1qbkb_ 309 331 2e-3 SMART
internal_repeat_1 343 402 1.86e-6 PROSPERO
low complexity region 445 454 N/A INTRINSIC
low complexity region 466 475 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 518 551 N/A INTRINSIC
low complexity region 571 596 N/A INTRINSIC
low complexity region 612 636 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,281 L775* probably null Het
Abcb8 A G 5: 24,400,621 S168G probably benign Het
Ankrd11 A G 8: 122,896,715 probably benign Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Atp8b1 A G 18: 64,533,729 probably benign Het
Camk2d A G 3: 126,771,839 D136G probably damaging Het
Capn3 G A 2: 120,485,287 D227N possibly damaging Het
Cwf19l2 A T 9: 3,456,803 H712L probably benign Het
Dlgap3 A G 4: 127,195,606 T332A probably damaging Het
Eml6 C A 11: 29,803,137 V925L probably benign Het
Fbll1 G A 11: 35,797,678 H253Y possibly damaging Het
Fbxw18 T A 9: 109,688,913 Y335F possibly damaging Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gm8251 A G 1: 44,058,866 V1024A probably benign Het
Ifi203 T A 1: 173,929,474 probably benign Het
Insig1 T A 5: 28,071,703 I89N probably damaging Het
Itpkc T A 7: 27,227,604 D295V possibly damaging Het
Jak1 T C 4: 101,191,468 probably benign Het
Kctd9 G A 14: 67,734,288 D157N possibly damaging Het
Kmt2c A C 5: 25,405,383 F242V probably benign Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Lin54 T C 5: 100,459,806 probably benign Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Myh9 G A 15: 77,766,812 R1612C probably damaging Het
Nr1d2 T A 14: 18,211,804 N433I possibly damaging Het
Olfr1217 T C 2: 89,023,610 Y131C probably damaging Het
Olfr1385 A G 11: 49,495,460 D309G possibly damaging Het
Olfr724 T C 14: 49,960,556 N172S possibly damaging Het
Pld4 T C 12: 112,768,035 I410T probably benign Het
Pramef8 T C 4: 143,416,642 probably benign Het
Rbbp8nl G T 2: 180,281,248 T184K probably benign Het
Saa4 T A 7: 46,729,629 N96Y possibly damaging Het
Serpinb6d T A 13: 33,667,680 V140E probably damaging Het
Ska3 A T 14: 57,811,596 M306K probably benign Het
Slfn4 T C 11: 83,185,311 M1T probably null Het
Sorcs1 T C 19: 50,151,221 I1168V probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
St18 G A 1: 6,855,473 probably null Het
Trim9 T C 12: 70,251,195 T579A probably damaging Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Ube2j1 A T 4: 33,036,723 M16L probably benign Het
Usp42 C T 5: 143,715,439 S943N probably benign Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Vmn2r62 G A 7: 42,787,887 P391L probably benign Het
Zfa-ps T A 10: 52,544,540 noncoding transcript Het
Zfp423 A G 8: 87,781,344 C666R probably damaging Het
Other mutations in Pnmal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Pnmal2 APN 7 16945163 missense unknown
IGL02023:Pnmal2 APN 7 16945691 missense probably damaging 0.97
FR4737:Pnmal2 UTSW 7 16946006 small deletion probably benign
R0085:Pnmal2 UTSW 7 16945549 missense unknown
R2069:Pnmal2 UTSW 7 16945789 missense probably damaging 0.99
R2151:Pnmal2 UTSW 7 16945912 missense probably benign 0.00
R2321:Pnmal2 UTSW 7 16945565 missense unknown
R2929:Pnmal2 UTSW 7 16946692 missense possibly damaging 0.93
R3739:Pnmal2 UTSW 7 16946596 missense probably benign 0.00
R5185:Pnmal2 UTSW 7 16945976 missense probably damaging 1.00
R5259:Pnmal2 UTSW 7 16945274 missense unknown
R5908:Pnmal2 UTSW 7 16947043 missense unknown
R5943:Pnmal2 UTSW 7 16946437 missense probably benign 0.25
R6101:Pnmal2 UTSW 7 16946568 missense probably benign 0.20
R6260:Pnmal2 UTSW 7 16946233 missense probably benign 0.03
R6583:Pnmal2 UTSW 7 16945919 missense probably damaging 0.97
R7007:Pnmal2 UTSW 7 16946256 missense possibly damaging 0.68
R7497:Pnmal2 UTSW 7 16944949 start gained probably benign
R8231:Pnmal2 UTSW 7 16946590 missense probably benign 0.01
R8278:Pnmal2 UTSW 7 16946338 missense probably damaging 0.99
RF003:Pnmal2 UTSW 7 16946016 small insertion probably benign
Z1176:Pnmal2 UTSW 7 16946810 missense possibly damaging 0.93
Z1177:Pnmal2 UTSW 7 16946968 missense unknown
Predicted Primers PCR Primer
(F):5'- ATTTCTACCTTGGCTGAGGCAG -3'
(R):5'- TTCTTCTCTGGGGTGACAGC -3'

Sequencing Primer
(F):5'- CTACCTTGGCTGAGGCAGAGAAC -3'
(R):5'- AGGCCTTTGGAGCCTGTGC -3'
Posted On2015-03-18