Incidental Mutation 'R3738:Pld4'
ID270253
Institutional Source Beutler Lab
Gene Symbol Pld4
Ensembl Gene ENSMUSG00000052160
Gene Namephospholipase D family, member 4
Synonymsthss
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3738 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location112760655-112768990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112768035 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 410 (I410T)
Ref Sequence ENSEMBL: ENSMUSP00000067002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063888] [ENSMUST00000101010] [ENSMUST00000128258]
Predicted Effect probably benign
Transcript: ENSMUST00000063888
AA Change: I410T

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000067002
Gene: ENSMUSG00000052160
AA Change: I410T

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 113 124 N/A INTRINSIC
PLDc 207 234 1.64e-10 SMART
Pfam:PLDc_3 237 414 5.5e-41 PFAM
PLDc 421 447 4.66e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101010
SMART Domains Protein: ENSMUSP00000098572
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 717 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128258
SMART Domains Protein: ENSMUSP00000122404
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
low complexity region 5 66 N/A INTRINSIC
internal_repeat_1 67 251 2.35e-83 PROSPERO
low complexity region 285 308 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
internal_repeat_1 413 597 2.35e-83 PROSPERO
low complexity region 734 756 N/A INTRINSIC
low complexity region 811 820 N/A INTRINSIC
low complexity region 1170 1181 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1523 1539 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222886
Meta Mutation Damage Score 0.0894 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: A spontaneous mutation that introduces a stop codon at residue 46 of 503 results in smaller body size and thin fur. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,281 L775* probably null Het
Abcb8 A G 5: 24,400,621 S168G probably benign Het
Ankrd11 A G 8: 122,896,715 probably benign Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Atp8b1 A G 18: 64,533,729 probably benign Het
Camk2d A G 3: 126,771,839 D136G probably damaging Het
Capn3 G A 2: 120,485,287 D227N possibly damaging Het
Cwf19l2 A T 9: 3,456,803 H712L probably benign Het
Dlgap3 A G 4: 127,195,606 T332A probably damaging Het
Eml6 C A 11: 29,803,137 V925L probably benign Het
Fbll1 G A 11: 35,797,678 H253Y possibly damaging Het
Fbxw18 T A 9: 109,688,913 Y335F possibly damaging Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gm8251 A G 1: 44,058,866 V1024A probably benign Het
Ifi203 T A 1: 173,929,474 probably benign Het
Insig1 T A 5: 28,071,703 I89N probably damaging Het
Itpkc T A 7: 27,227,604 D295V possibly damaging Het
Jak1 T C 4: 101,191,468 probably benign Het
Kctd9 G A 14: 67,734,288 D157N possibly damaging Het
Kmt2c A C 5: 25,405,383 F242V probably benign Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Lin54 T C 5: 100,459,806 probably benign Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Myh9 G A 15: 77,766,812 R1612C probably damaging Het
Nr1d2 T A 14: 18,211,804 N433I possibly damaging Het
Olfr1217 T C 2: 89,023,610 Y131C probably damaging Het
Olfr1385 A G 11: 49,495,460 D309G possibly damaging Het
Olfr724 T C 14: 49,960,556 N172S possibly damaging Het
Pnmal2 C T 7: 16,946,596 H502Y probably benign Het
Pramef8 T C 4: 143,416,642 probably benign Het
Rbbp8nl G T 2: 180,281,248 T184K probably benign Het
Saa4 T A 7: 46,729,629 N96Y possibly damaging Het
Serpinb6d T A 13: 33,667,680 V140E probably damaging Het
Ska3 A T 14: 57,811,596 M306K probably benign Het
Slfn4 T C 11: 83,185,311 M1T probably null Het
Sorcs1 T C 19: 50,151,221 I1168V probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
St18 G A 1: 6,855,473 probably null Het
Trim9 T C 12: 70,251,195 T579A probably damaging Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Ube2j1 A T 4: 33,036,723 M16L probably benign Het
Usp42 C T 5: 143,715,439 S943N probably benign Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Vmn2r62 G A 7: 42,787,887 P391L probably benign Het
Zfa-ps T A 10: 52,544,540 noncoding transcript Het
Zfp423 A G 8: 87,781,344 C666R probably damaging Het
Other mutations in Pld4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Pld4 APN 12 112763491 missense probably benign 0.01
IGL01839:Pld4 APN 12 112765079 missense probably damaging 1.00
IGL01954:Pld4 APN 12 112767921 critical splice donor site probably null
IGL02253:Pld4 APN 12 112766707 missense probably damaging 1.00
IGL03149:Pld4 APN 12 112766829 missense probably benign 0.00
IGL03278:Pld4 APN 12 112766731 missense probably damaging 0.98
IGL03349:Pld4 APN 12 112767879 missense probably benign 0.01
Lipodicum UTSW 12 112765064 missense probably damaging 1.00
PIT4403001:Pld4 UTSW 12 112767822 missense probably damaging 1.00
PIT4468001:Pld4 UTSW 12 112767822 missense probably damaging 1.00
R0052:Pld4 UTSW 12 112767857 missense probably benign 0.03
R1078:Pld4 UTSW 12 112763442 missense probably benign
R1756:Pld4 UTSW 12 112763392 splice site probably null
R2006:Pld4 UTSW 12 112768489 missense possibly damaging 0.89
R2037:Pld4 UTSW 12 112768558 missense probably damaging 1.00
R4630:Pld4 UTSW 12 112765064 missense probably damaging 1.00
R4911:Pld4 UTSW 12 112764517 missense probably benign 0.01
R5008:Pld4 UTSW 12 112768050 missense possibly damaging 0.89
R5263:Pld4 UTSW 12 112765031 missense probably damaging 1.00
R5310:Pld4 UTSW 12 112768612 missense probably damaging 1.00
R5386:Pld4 UTSW 12 112763988 nonsense probably null
R5513:Pld4 UTSW 12 112762554 missense probably benign
R5788:Pld4 UTSW 12 112764117 missense probably benign
R6085:Pld4 UTSW 12 112766886 missense probably benign 0.01
R6157:Pld4 UTSW 12 112768101 missense probably damaging 1.00
R6702:Pld4 UTSW 12 112765051 missense probably damaging 1.00
R6767:Pld4 UTSW 12 112764115 missense possibly damaging 0.51
R6962:Pld4 UTSW 12 112766854 missense probably benign 0.00
R7864:Pld4 UTSW 12 112765123 missense probably damaging 1.00
R8792:Pld4 UTSW 12 112763490 missense probably benign 0.00
R8826:Pld4 UTSW 12 112766776 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTCAATAAGGGTGTGCATGTGC -3'
(R):5'- AAGCTGGGCTAAGTGTCTG -3'

Sequencing Primer
(F):5'- TCAGCTGCTGGTTCAACACAG -3'
(R):5'- TGGCTCCCAGGATATGTGAGC -3'
Posted On2015-03-18