Incidental Mutation 'R3738:Ska3'
ID270258
Institutional Source Beutler Lab
Gene Symbol Ska3
Ensembl Gene ENSMUSG00000021965
Gene Namespindle and kinetochore associated complex subunit 3
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R3738 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location57806561-57826185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57811596 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 306 (M306K)
Ref Sequence ENSEMBL: ENSMUSP00000022536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022536] [ENSMUST00000128764]
Predicted Effect probably benign
Transcript: ENSMUST00000022536
AA Change: M306K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022536
Gene: ENSMUSG00000021965
AA Change: M306K

DomainStartEndE-ValueType
PDB:4AJ5|Z 1 101 3e-46 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000128764
SMART Domains Protein: ENSMUSP00000120071
Gene: ENSMUSG00000021963

DomainStartEndE-ValueType
Pfam:SAP18 38 156 2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225646
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the spindle and kinetochore-associated protein complex that regulates microtubule attachment to the kinetochores during mitosis. The encoded protein localizes to the outer kinetechore and may be required for normal chromosome segregation and cell division. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,281 L775* probably null Het
Abcb8 A G 5: 24,400,621 S168G probably benign Het
Ankrd11 A G 8: 122,896,715 probably benign Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Atp8b1 A G 18: 64,533,729 probably benign Het
Camk2d A G 3: 126,771,839 D136G probably damaging Het
Capn3 G A 2: 120,485,287 D227N possibly damaging Het
Cwf19l2 A T 9: 3,456,803 H712L probably benign Het
Dlgap3 A G 4: 127,195,606 T332A probably damaging Het
Eml6 C A 11: 29,803,137 V925L probably benign Het
Fbll1 G A 11: 35,797,678 H253Y possibly damaging Het
Fbxw18 T A 9: 109,688,913 Y335F possibly damaging Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gm8251 A G 1: 44,058,866 V1024A probably benign Het
Ifi203 T A 1: 173,929,474 probably benign Het
Insig1 T A 5: 28,071,703 I89N probably damaging Het
Itpkc T A 7: 27,227,604 D295V possibly damaging Het
Jak1 T C 4: 101,191,468 probably benign Het
Kctd9 G A 14: 67,734,288 D157N possibly damaging Het
Kmt2c A C 5: 25,405,383 F242V probably benign Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Lin54 T C 5: 100,459,806 probably benign Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Myh9 G A 15: 77,766,812 R1612C probably damaging Het
Nr1d2 T A 14: 18,211,804 N433I possibly damaging Het
Olfr1217 T C 2: 89,023,610 Y131C probably damaging Het
Olfr1385 A G 11: 49,495,460 D309G possibly damaging Het
Olfr724 T C 14: 49,960,556 N172S possibly damaging Het
Pld4 T C 12: 112,768,035 I410T probably benign Het
Pnmal2 C T 7: 16,946,596 H502Y probably benign Het
Pramef8 T C 4: 143,416,642 probably benign Het
Rbbp8nl G T 2: 180,281,248 T184K probably benign Het
Saa4 T A 7: 46,729,629 N96Y possibly damaging Het
Serpinb6d T A 13: 33,667,680 V140E probably damaging Het
Slfn4 T C 11: 83,185,311 M1T probably null Het
Sorcs1 T C 19: 50,151,221 I1168V probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
St18 G A 1: 6,855,473 probably null Het
Trim9 T C 12: 70,251,195 T579A probably damaging Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Ube2j1 A T 4: 33,036,723 M16L probably benign Het
Usp42 C T 5: 143,715,439 S943N probably benign Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Vmn2r62 G A 7: 42,787,887 P391L probably benign Het
Zfa-ps T A 10: 52,544,540 noncoding transcript Het
Zfp423 A G 8: 87,781,344 C666R probably damaging Het
Other mutations in Ska3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Ska3 APN 14 57822124 missense possibly damaging 0.95
IGL01969:Ska3 APN 14 57811662 missense probably benign 0.00
IGL02539:Ska3 APN 14 57820511 missense possibly damaging 0.86
IGL02665:Ska3 APN 14 57822072 missense probably damaging 1.00
R1276:Ska3 UTSW 14 57820269 missense probably damaging 1.00
R3737:Ska3 UTSW 14 57811596 missense probably benign 0.00
R3771:Ska3 UTSW 14 57810077 missense probably benign 0.06
R3772:Ska3 UTSW 14 57810077 missense probably benign 0.06
R3773:Ska3 UTSW 14 57810077 missense probably benign 0.06
R5269:Ska3 UTSW 14 57822116 missense possibly damaging 0.87
R6088:Ska3 UTSW 14 57816694 missense probably benign 0.01
R6320:Ska3 UTSW 14 57816691 missense probably benign 0.04
R7792:Ska3 UTSW 14 57810055 missense probably damaging 0.97
R8108:Ska3 UTSW 14 57826102 missense probably damaging 1.00
R8362:Ska3 UTSW 14 57816648 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CCAGTCACATTGGTTCCATGC -3'
(R):5'- AGATTGCATTCCCAGCAACC -3'

Sequencing Primer
(F):5'- GTTACAGATCTGCACCAATTTGC -3'
(R):5'- GGTGGCTCACAACCATCTGTAATG -3'
Posted On2015-03-18