Mutagenetix > Incidental Mutations

Incidental Mutation 'R3738:Ska3'

270258

Institutional Source

Beutler Lab

Gene Symbol

Ska3

Ensembl Gene

ENSMUSG00000021965

Gene Name

spindle and kinetochore associated complex subunit 3

Synonyms

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.930) question?

Stock #

R3738 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57806561-57826185 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 57811596 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 306 (M306K)

Ref Sequence

ENSEMBL: ENSMUSP00000022536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022536] [ENSMUST00000128764]

Predicted Effect

probably benign
Transcript: ENSMUST00000022536
AA Change: M306K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000022536
Gene: ENSMUSG00000021965
AA Change: M306K

Domain	Start	End	E-Value	Type
PDB:4AJ5\|Z	1	101	3e-46	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000128764

SMART Domains

Protein: ENSMUSP00000120071
Gene: ENSMUSG00000021963

Domain	Start	End	E-Value	Type
Pfam:SAP18	38	156	2e-47	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224108

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225646

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the spindle and kinetochore-associated protein complex that regulates microtubule attachment to the kinetochores during mitosis. The encoded protein localizes to the outer kinetechore and may be required for normal chromosome segregation and cell division. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik2	A	T	11: 49,019,281	L775*	probably null	Het
Abcb8	A	G	5: 24,400,621	S168G	probably benign	Het
Ankrd11	A	G	8: 122,896,715		probably benign	Het
Api5	C	T	2: 94,425,613	R243Q	possibly damaging	Het
Atp8b1	A	G	18: 64,533,729		probably benign	Het
Camk2d	A	G	3: 126,771,839	D136G	probably damaging	Het
Capn3	G	A	2: 120,485,287	D227N	possibly damaging	Het
Cwf19l2	A	T	9: 3,456,803	H712L	probably benign	Het
Dlgap3	A	G	4: 127,195,606	T332A	probably damaging	Het
Eml6	C	A	11: 29,803,137	V925L	probably benign	Het
Fbll1	G	A	11: 35,797,678	H253Y	possibly damaging	Het
Fbxw18	T	A	9: 109,688,913	Y335F	possibly damaging	Het
Gbp10	T	A	5: 105,224,458	E145D	possibly damaging	Het
Gm8251	A	G	1: 44,058,866	V1024A	probably benign	Het
Ifi203	T	A	1: 173,929,474		probably benign	Het
Insig1	T	A	5: 28,071,703	I89N	probably damaging	Het
Itpkc	T	A	7: 27,227,604	D295V	possibly damaging	Het
Jak1	T	C	4: 101,191,468		probably benign	Het
Kctd9	G	A	14: 67,734,288	D157N	possibly damaging	Het
Kmt2c	A	C	5: 25,405,383	F242V	probably benign	Het
Lcorl	A	T	5: 45,734,041	N323K	possibly damaging	Het
Lin54	T	C	5: 100,459,806		probably benign	Het
Ltbp2	A	T	12: 84,804,474	C836S	probably damaging	Het
Mfsd2b	A	G	12: 4,870,578	S80P	probably damaging	Het
Myh9	G	A	15: 77,766,812	R1612C	probably damaging	Het
Nr1d2	T	A	14: 18,211,804	N433I	possibly damaging	Het
Olfr1217	T	C	2: 89,023,610	Y131C	probably damaging	Het
Olfr1385	A	G	11: 49,495,460	D309G	possibly damaging	Het
Olfr724	T	C	14: 49,960,556	N172S	possibly damaging	Het
Pld4	T	C	12: 112,768,035	I410T	probably benign	Het
Pnmal2	C	T	7: 16,946,596	H502Y	probably benign	Het
Pramef8	T	C	4: 143,416,642		probably benign	Het
Rbbp8nl	G	T	2: 180,281,248	T184K	probably benign	Het
Saa4	T	A	7: 46,729,629	N96Y	possibly damaging	Het
Serpinb6d	T	A	13: 33,667,680	V140E	probably damaging	Het
Slfn4	T	C	11: 83,185,311	M1T	probably null	Het
Sorcs1	T	C	19: 50,151,221	I1168V	probably benign	Het
Srsf4	C	T	4: 131,900,102		probably benign	Het
St18	G	A	1: 6,855,473		probably null	Het
Trim9	T	C	12: 70,251,195	T579A	probably damaging	Het
Trpc2	G	A	7: 102,084,504	S220N	probably damaging	Het
Ube2j1	A	T	4: 33,036,723	M16L	probably benign	Het
Usp42	C	T	5: 143,715,439	S943N	probably benign	Het
Utp20	C	T	10: 88,762,806	V103I	probably benign	Het
Vmn2r62	G	A	7: 42,787,887	P391L	probably benign	Het
Zfa-ps	T	A	10: 52,544,540		noncoding transcript	Het
Zfp423	A	G	8: 87,781,344	C666R	probably damaging	Het

Other mutations in Ska3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00961:Ska3	APN	14	57822124	missense	possibly damaging	0.95
IGL01969:Ska3	APN	14	57811662	missense	probably benign	0.00
IGL02539:Ska3	APN	14	57820511	missense	possibly damaging	0.86
IGL02665:Ska3	APN	14	57822072	missense	probably damaging	1.00
R1276:Ska3	UTSW	14	57820269	missense	probably damaging	1.00
R3737:Ska3	UTSW	14	57811596	missense	probably benign	0.00
R3771:Ska3	UTSW	14	57810077	missense	probably benign	0.06
R3772:Ska3	UTSW	14	57810077	missense	probably benign	0.06
R3773:Ska3	UTSW	14	57810077	missense	probably benign	0.06
R5269:Ska3	UTSW	14	57822116	missense	possibly damaging	0.87
R6088:Ska3	UTSW	14	57816694	missense	probably benign	0.01
R6320:Ska3	UTSW	14	57816691	missense	probably benign	0.04
R7792:Ska3	UTSW	14	57810055	missense	probably damaging	0.97
R8108:Ska3	UTSW	14	57826102	missense	probably damaging	1.00
R8362:Ska3	UTSW	14	57816648	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- CCAGTCACATTGGTTCCATGC -3'
(R):5'- AGATTGCATTCCCAGCAACC -3'

Sequencing Primer
(F):5'- GTTACAGATCTGCACCAATTTGC -3'
(R):5'- GGTGGCTCACAACCATCTGTAATG -3'

Posted On

2015-03-18