Incidental Mutation 'R3739:Abcb8'
ID270280
Institutional Source Beutler Lab
Gene Symbol Abcb8
Ensembl Gene ENSMUSG00000028973
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 8
Synonyms
MMRRC Submission 040725-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R3739 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24393663-24410054 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24400621 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 168 (S168G)
Ref Sequence ENSEMBL: ENSMUSP00000110729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073076] [ENSMUST00000115077] [ENSMUST00000138168]
Predicted Effect probably benign
Transcript: ENSMUST00000073076
AA Change: S168G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072826
Gene: ENSMUSG00000028973
AA Change: S168G

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 3.6e-48 PFAM
AAA 481 668 8.58e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115074
SMART Domains Protein: ENSMUSP00000110726
Gene: ENSMUSG00000028973

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 2.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115077
AA Change: S168G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110729
Gene: ENSMUSG00000028973
AA Change: S168G

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 1.1e-56 PFAM
AAA 481 668 8.58e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136414
Predicted Effect probably benign
Transcript: ENSMUST00000138168
SMART Domains Protein: ENSMUSP00000119791
Gene: ENSMUSG00000028973

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000198166
AA Change: S8G
Meta Mutation Damage Score 0.1056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a multi-pass membrane protein that is targeted to the mitochondrial inner membrane. The encoded protein is an ATP-dependent transporter that may mediate the passage of organic and inorganic molecules out of the mitochondria. Loss of function of the related gene in mouse results in a disruption of iron homeostasis between the mitochondria and cytosol. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Inducible cardiac specific deletion results in mild cardiomyopathy, mitochondrial defects and elevated heart mitochondrial iron levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,281 L775* probably null Het
Ahnak2 T C 12: 112,774,558 I1027V probably benign Het
Alox12e A G 11: 70,319,842 L318P probably damaging Het
Ankrd11 A G 8: 122,896,715 probably benign Het
Anks1b T A 10: 90,033,216 I46N probably damaging Het
Apoa5 G C 9: 46,269,117 W7S probably damaging Het
Arnt2 T C 7: 84,343,801 H177R probably null Het
Cacna1c T C 6: 118,741,952 D220G probably benign Het
Dst C T 1: 34,268,894 probably benign Het
Eml6 C A 11: 29,803,137 V925L probably benign Het
Fbll1 G A 11: 35,797,678 H253Y possibly damaging Het
Galnt1 A G 18: 24,271,655 T350A probably benign Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gfm1 T C 3: 67,456,700 I503T probably damaging Het
Hmcn2 A T 2: 31,336,612 K200* probably null Het
Ifi203 T A 1: 173,929,474 probably benign Het
Itgbl1 T C 14: 123,966,678 F394L probably damaging Het
Itpkc T A 7: 27,227,604 D295V possibly damaging Het
Klra17 T A 6: 129,873,365 I41F probably benign Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Ms4a18 A T 19: 11,011,499 H164Q probably damaging Het
Mybbp1a A G 11: 72,448,737 H882R possibly damaging Het
Myh9 G A 15: 77,766,812 R1612C probably damaging Het
Myo18a A G 11: 77,845,615 D1514G probably damaging Het
Nsun2 T C 13: 69,629,638 I441T probably benign Het
Ntng1 A T 3: 109,934,691 D255E probably damaging Het
Olfr1385 A G 11: 49,495,460 D309G possibly damaging Het
Osbpl2 G A 2: 180,161,560 R475H probably damaging Het
Pclo A C 5: 14,680,899 K3138N unknown Het
Pcsk7 A G 9: 45,926,759 T572A possibly damaging Het
Pex11a C T 7: 79,740,170 R56H possibly damaging Het
Pnmal2 C T 7: 16,946,596 H502Y probably benign Het
Saa4 T A 7: 46,729,629 N96Y possibly damaging Het
Serpinb6d T A 13: 33,667,680 V140E probably damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
St18 G A 1: 6,855,473 probably null Het
Taf3 T C 2: 9,951,658 E566G possibly damaging Het
Tnr T C 1: 159,923,413 S1315P possibly damaging Het
Trappc11 T C 8: 47,514,103 E412G probably damaging Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Trpm7 A G 2: 126,851,521 V48A probably damaging Het
Tubb6 A G 18: 67,402,051 Y340C probably damaging Het
Vmn1r197 C A 13: 22,328,576 Y222* probably null Het
Vmn2r97 T C 17: 18,928,151 S103P probably damaging Het
Zfp362 C G 4: 128,786,889 probably benign Het
Zfp423 A G 8: 87,781,344 C666R probably damaging Het
Other mutations in Abcb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02349:Abcb8 APN 5 24406464 missense probably benign
IGL02819:Abcb8 APN 5 24406424 missense probably benign
Thumbs UTSW 5 24402103 missense probably damaging 0.99
R0320:Abcb8 UTSW 5 24400790 missense probably damaging 1.00
R0458:Abcb8 UTSW 5 24406233 missense probably benign 0.02
R0927:Abcb8 UTSW 5 24402319 missense probably damaging 1.00
R1120:Abcb8 UTSW 5 24408820 critical splice donor site probably null
R1553:Abcb8 UTSW 5 24408750 missense probably damaging 1.00
R3738:Abcb8 UTSW 5 24400621 missense probably benign 0.00
R4035:Abcb8 UTSW 5 24400621 missense probably benign 0.00
R4303:Abcb8 UTSW 5 24401057 missense probably damaging 1.00
R4930:Abcb8 UTSW 5 24400781 missense possibly damaging 0.89
R5369:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5370:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5485:Abcb8 UTSW 5 24400161 missense probably benign 0.01
R5505:Abcb8 UTSW 5 24401038 missense probably damaging 1.00
R5627:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5633:Abcb8 UTSW 5 24403109 missense probably damaging 1.00
R5693:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5761:Abcb8 UTSW 5 24405881 intron probably benign
R5866:Abcb8 UTSW 5 24402103 missense probably damaging 0.99
R5995:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5996:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R6621:Abcb8 UTSW 5 24394510 missense probably benign
R7407:Abcb8 UTSW 5 24400676 missense probably benign 0.00
X0026:Abcb8 UTSW 5 24401046 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTTTTGTGACATGGATGGCC -3'
(R):5'- ATGTGGGACAGCAGCACTAG -3'

Sequencing Primer
(F):5'- TGTGGACAAGGCAAGGCTG -3'
(R):5'- CTAGGTATCCAAAGGTCAGCAGTC -3'
Posted On2015-03-18