Incidental Mutation 'R3739:Arnt2'
ID 270289
Institutional Source Beutler Lab
Gene Symbol Arnt2
Ensembl Gene ENSMUSG00000015709
Gene Name aryl hydrocarbon receptor nuclear translocator 2
Synonyms bHLHe1
MMRRC Submission 040725-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3739 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 83895486-84059201 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83993009 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 177 (H177R)
Ref Sequence ENSEMBL: ENSMUSP00000147129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085077] [ENSMUST00000207769] [ENSMUST00000208204] [ENSMUST00000208232] [ENSMUST00000208232] [ENSMUST00000208392] [ENSMUST00000209133] [ENSMUST00000209133] [ENSMUST00000208995] [ENSMUST00000208863]
AlphaFold Q61324
Predicted Effect probably null
Transcript: ENSMUST00000085077
AA Change: H188R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082154
Gene: ENSMUSG00000015709
AA Change: H188R

DomainStartEndE-ValueType
HLH 69 122 1.42e-14 SMART
PAS 137 204 1.28e-8 SMART
low complexity region 225 236 N/A INTRINSIC
PAS 325 391 4.15e-8 SMART
PAC 398 441 7.93e-5 SMART
low complexity region 502 526 N/A INTRINSIC
low complexity region 597 626 N/A INTRINSIC
low complexity region 653 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207512
Predicted Effect probably null
Transcript: ENSMUST00000207769
Predicted Effect probably benign
Transcript: ENSMUST00000208204
Predicted Effect probably null
Transcript: ENSMUST00000208232
AA Change: H177R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably null
Transcript: ENSMUST00000208232
AA Change: H177R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably null
Transcript: ENSMUST00000208392
Predicted Effect probably null
Transcript: ENSMUST00000209133
AA Change: H177R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably null
Transcript: ENSMUST00000209133
AA Change: H177R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably null
Transcript: ENSMUST00000208995
AA Change: H177R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably null
Transcript: ENSMUST00000208863
Meta Mutation Damage Score 0.9565 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic-helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) superfamily of transcription factors. The encoded protein acts as a partner for several sensor proteins of the bHLH-PAS family, forming heterodimers with the sensor proteins that bind regulatory DNA sequences in genes responsive to developmental and environmental stimuli. Under hypoxic conditions, the encoded protein complexes with hypoxia-inducible factor 1alpha in the nucleus and this complex binds to hypoxia-responsive elements in enhancers and promoters of oxygen-responsive genes. A highly similar protein in mouse forms functional complexes with both aryl hydrocarbon receptors and Single-minded proteins, suggesting additional roles for the encoded protein in the metabolism of xenobiotic compounds and the regulation of neurogenesis, respectively. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate this gene die shortly after birth, displaying impaired development of secretory neurons in the hypothalamus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 48,910,108 (GRCm39) L775* probably null Het
Abcb8 A G 5: 24,605,619 (GRCm39) S168G probably benign Het
Ahnak2 T C 12: 112,740,992 (GRCm39) I1027V probably benign Het
Alox12e A G 11: 70,210,668 (GRCm39) L318P probably damaging Het
Ankrd11 A G 8: 123,623,454 (GRCm39) probably benign Het
Anks1b T A 10: 89,869,078 (GRCm39) I46N probably damaging Het
Apoa5 G C 9: 46,180,415 (GRCm39) W7S probably damaging Het
Cacna1c T C 6: 118,718,913 (GRCm39) D220G probably benign Het
Dst C T 1: 34,307,975 (GRCm39) probably benign Het
Eml6 C A 11: 29,753,137 (GRCm39) V925L probably benign Het
Fbll1 G A 11: 35,688,505 (GRCm39) H253Y possibly damaging Het
Galnt1 A G 18: 24,404,712 (GRCm39) T350A probably benign Het
Gbp10 T A 5: 105,372,324 (GRCm39) E145D possibly damaging Het
Gfm1 T C 3: 67,364,033 (GRCm39) I503T probably damaging Het
Hmcn2 A T 2: 31,226,624 (GRCm39) K200* probably null Het
Ifi203 T A 1: 173,757,040 (GRCm39) probably benign Het
Itgbl1 T C 14: 124,204,090 (GRCm39) F394L probably damaging Het
Itpkc T A 7: 26,927,029 (GRCm39) D295V possibly damaging Het
Klra17 T A 6: 129,850,328 (GRCm39) I41F probably benign Het
Lcorl A T 5: 45,891,383 (GRCm39) N323K possibly damaging Het
Ltbp2 A T 12: 84,851,248 (GRCm39) C836S probably damaging Het
Mfsd2b A G 12: 4,920,578 (GRCm39) S80P probably damaging Het
Ms4a18 A T 19: 10,988,863 (GRCm39) H164Q probably damaging Het
Mybbp1a A G 11: 72,339,563 (GRCm39) H882R possibly damaging Het
Myh9 G A 15: 77,651,012 (GRCm39) R1612C probably damaging Het
Myo18a A G 11: 77,736,441 (GRCm39) D1514G probably damaging Het
Nsun2 T C 13: 69,777,757 (GRCm39) I441T probably benign Het
Ntng1 A T 3: 109,842,007 (GRCm39) D255E probably damaging Het
Or2y1 A G 11: 49,386,287 (GRCm39) D309G possibly damaging Het
Osbpl2 G A 2: 179,803,353 (GRCm39) R475H probably damaging Het
Pclo A C 5: 14,730,913 (GRCm39) K3138N unknown Het
Pcsk7 A G 9: 45,838,057 (GRCm39) T572A possibly damaging Het
Pex11a C T 7: 79,389,918 (GRCm39) R56H possibly damaging Het
Pnma8b C T 7: 16,680,521 (GRCm39) H502Y probably benign Het
Saa4 T A 7: 46,379,053 (GRCm39) N96Y possibly damaging Het
Serpinb6d T A 13: 33,851,663 (GRCm39) V140E probably damaging Het
Srsf4 C T 4: 131,627,413 (GRCm39) probably benign Het
St18 G A 1: 6,925,697 (GRCm39) probably null Het
Taf3 T C 2: 9,956,469 (GRCm39) E566G possibly damaging Het
Tnr T C 1: 159,750,983 (GRCm39) S1315P possibly damaging Het
Trappc11 T C 8: 47,967,138 (GRCm39) E412G probably damaging Het
Trpc2 G A 7: 101,733,711 (GRCm39) S220N probably damaging Het
Trpm7 A G 2: 126,693,441 (GRCm39) V48A probably damaging Het
Tubb6 A G 18: 67,535,121 (GRCm39) Y340C probably damaging Het
Vmn1r197 C A 13: 22,512,746 (GRCm39) Y222* probably null Het
Vmn2r97 T C 17: 19,148,413 (GRCm39) S103P probably damaging Het
Zfp362 C G 4: 128,680,682 (GRCm39) probably benign Het
Zfp423 A G 8: 88,507,972 (GRCm39) C666R probably damaging Het
Other mutations in Arnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Arnt2 APN 7 83,935,037 (GRCm39) missense probably benign 0.01
IGL01525:Arnt2 APN 7 83,924,616 (GRCm39) missense possibly damaging 0.70
IGL02331:Arnt2 APN 7 83,914,832 (GRCm39) missense probably damaging 1.00
IGL02483:Arnt2 APN 7 83,900,605 (GRCm39) missense probably damaging 1.00
IGL02863:Arnt2 APN 7 83,917,145 (GRCm39) missense probably damaging 1.00
IGL03207:Arnt2 APN 7 83,993,042 (GRCm39) missense possibly damaging 0.93
Arnold2 UTSW 7 83,996,738 (GRCm39) missense probably damaging 1.00
porker UTSW 7 83,993,150 (GRCm39) missense probably damaging 1.00
R0024:Arnt2 UTSW 7 83,933,334 (GRCm39) missense probably benign 0.03
R0058:Arnt2 UTSW 7 83,996,738 (GRCm39) missense probably damaging 1.00
R0058:Arnt2 UTSW 7 83,996,738 (GRCm39) missense probably damaging 1.00
R0060:Arnt2 UTSW 7 83,996,738 (GRCm39) missense probably damaging 1.00
R0113:Arnt2 UTSW 7 83,996,738 (GRCm39) missense probably damaging 1.00
R0114:Arnt2 UTSW 7 83,996,738 (GRCm39) missense probably damaging 1.00
R0201:Arnt2 UTSW 7 84,010,867 (GRCm39) nonsense probably null
R0514:Arnt2 UTSW 7 83,954,067 (GRCm39) missense probably benign 0.00
R0863:Arnt2 UTSW 7 83,914,792 (GRCm39) missense probably damaging 1.00
R1800:Arnt2 UTSW 7 83,924,583 (GRCm39) missense probably damaging 1.00
R1944:Arnt2 UTSW 7 83,992,959 (GRCm39) missense probably benign 0.01
R1964:Arnt2 UTSW 7 83,992,997 (GRCm39) missense possibly damaging 0.55
R2061:Arnt2 UTSW 7 83,993,078 (GRCm39) missense probably damaging 1.00
R2216:Arnt2 UTSW 7 83,924,559 (GRCm39) missense probably damaging 0.99
R3107:Arnt2 UTSW 7 83,911,652 (GRCm39) missense possibly damaging 0.95
R3410:Arnt2 UTSW 7 83,924,655 (GRCm39) missense probably damaging 1.00
R4258:Arnt2 UTSW 7 83,960,163 (GRCm39) missense probably damaging 0.98
R4486:Arnt2 UTSW 7 83,924,553 (GRCm39) missense probably benign 0.03
R4489:Arnt2 UTSW 7 83,924,553 (GRCm39) missense probably benign 0.03
R4668:Arnt2 UTSW 7 83,924,594 (GRCm39) missense probably damaging 1.00
R5685:Arnt2 UTSW 7 83,912,473 (GRCm39) missense probably benign 0.00
R5876:Arnt2 UTSW 7 83,996,720 (GRCm39) missense probably damaging 1.00
R5923:Arnt2 UTSW 7 83,911,741 (GRCm39) missense probably benign 0.32
R5926:Arnt2 UTSW 7 83,993,154 (GRCm39) missense probably damaging 0.99
R6122:Arnt2 UTSW 7 84,010,773 (GRCm39) missense probably damaging 1.00
R7021:Arnt2 UTSW 7 83,993,150 (GRCm39) missense probably damaging 1.00
R7895:Arnt2 UTSW 7 83,954,406 (GRCm39) missense probably benign
R7898:Arnt2 UTSW 7 83,918,155 (GRCm39) splice site probably null
R8386:Arnt2 UTSW 7 83,996,747 (GRCm39) missense probably damaging 1.00
R9038:Arnt2 UTSW 7 83,954,059 (GRCm39) missense probably benign
R9258:Arnt2 UTSW 7 84,010,798 (GRCm39) missense probably damaging 1.00
R9346:Arnt2 UTSW 7 83,931,321 (GRCm39) missense probably benign 0.04
R9452:Arnt2 UTSW 7 83,933,334 (GRCm39) missense probably benign 0.03
R9636:Arnt2 UTSW 7 83,993,042 (GRCm39) missense probably benign 0.44
R9780:Arnt2 UTSW 7 83,954,426 (GRCm39) missense probably benign 0.02
X0066:Arnt2 UTSW 7 83,934,992 (GRCm39) missense possibly damaging 0.93
Z1176:Arnt2 UTSW 7 83,912,404 (GRCm39) missense probably benign 0.41
Z1177:Arnt2 UTSW 7 83,912,415 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGCTTCCAAATGTGTTTACTGG -3'
(R):5'- CTGTTAGGACCCTTGCTGAC -3'

Sequencing Primer
(F):5'- GAAATCACTCTGTTGACCAGGCTG -3'
(R):5'- ACCCTTGCTGACCACGG -3'
Posted On 2015-03-18