Incidental Mutation 'R3739:Alox12e'
ID 270302
Institutional Source Beutler Lab
Gene Symbol Alox12e
Ensembl Gene ENSMUSG00000018907
Gene Name arachidonate lipoxygenase, epidermal
Synonyms 8-LOX, Alox12-ps1, Alox12-ps2, Aloxe, e-LOX1
MMRRC Submission 040725-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3739 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 70315610-70322628 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70319842 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 318 (L318P)
Ref Sequence ENSEMBL: ENSMUSP00000019051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019051]
AlphaFold P55249
Predicted Effect probably damaging
Transcript: ENSMUST00000019051
AA Change: L318P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019051
Gene: ENSMUSG00000018907
AA Change: L318P

DomainStartEndE-ValueType
LH2 2 111 9.49e-38 SMART
Pfam:Lipoxygenase 163 649 1.2e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149060
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,281 L775* probably null Het
Abcb8 A G 5: 24,400,621 S168G probably benign Het
Ahnak2 T C 12: 112,774,558 I1027V probably benign Het
Ankrd11 A G 8: 122,896,715 probably benign Het
Anks1b T A 10: 90,033,216 I46N probably damaging Het
Apoa5 G C 9: 46,269,117 W7S probably damaging Het
Arnt2 T C 7: 84,343,801 H177R probably null Het
Cacna1c T C 6: 118,741,952 D220G probably benign Het
Dst C T 1: 34,268,894 probably benign Het
Eml6 C A 11: 29,803,137 V925L probably benign Het
Fbll1 G A 11: 35,797,678 H253Y possibly damaging Het
Galnt1 A G 18: 24,271,655 T350A probably benign Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gfm1 T C 3: 67,456,700 I503T probably damaging Het
Hmcn2 A T 2: 31,336,612 K200* probably null Het
Ifi203 T A 1: 173,929,474 probably benign Het
Itgbl1 T C 14: 123,966,678 F394L probably damaging Het
Itpkc T A 7: 27,227,604 D295V possibly damaging Het
Klra17 T A 6: 129,873,365 I41F probably benign Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Ms4a18 A T 19: 11,011,499 H164Q probably damaging Het
Mybbp1a A G 11: 72,448,737 H882R possibly damaging Het
Myh9 G A 15: 77,766,812 R1612C probably damaging Het
Myo18a A G 11: 77,845,615 D1514G probably damaging Het
Nsun2 T C 13: 69,629,638 I441T probably benign Het
Ntng1 A T 3: 109,934,691 D255E probably damaging Het
Olfr1385 A G 11: 49,495,460 D309G possibly damaging Het
Osbpl2 G A 2: 180,161,560 R475H probably damaging Het
Pclo A C 5: 14,680,899 K3138N unknown Het
Pcsk7 A G 9: 45,926,759 T572A possibly damaging Het
Pex11a C T 7: 79,740,170 R56H possibly damaging Het
Pnmal2 C T 7: 16,946,596 H502Y probably benign Het
Saa4 T A 7: 46,729,629 N96Y possibly damaging Het
Serpinb6d T A 13: 33,667,680 V140E probably damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
St18 G A 1: 6,855,473 probably null Het
Taf3 T C 2: 9,951,658 E566G possibly damaging Het
Tnr T C 1: 159,923,413 S1315P possibly damaging Het
Trappc11 T C 8: 47,514,103 E412G probably damaging Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Trpm7 A G 2: 126,851,521 V48A probably damaging Het
Tubb6 A G 18: 67,402,051 Y340C probably damaging Het
Vmn1r197 C A 13: 22,328,576 Y222* probably null Het
Vmn2r97 T C 17: 18,928,151 S103P probably damaging Het
Zfp362 C G 4: 128,786,889 probably benign Het
Zfp423 A G 8: 87,781,344 C666R probably damaging Het
Other mutations in Alox12e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Alox12e APN 11 70321054 missense probably benign
IGL01781:Alox12e APN 11 70321456 missense probably damaging 1.00
R0284:Alox12e UTSW 11 70320899 splice site probably benign
R0417:Alox12e UTSW 11 70321865 missense probably benign 0.12
R0557:Alox12e UTSW 11 70321448 missense possibly damaging 0.80
R0593:Alox12e UTSW 11 70320897 splice site probably benign
R1479:Alox12e UTSW 11 70320782 missense probably benign 0.04
R1967:Alox12e UTSW 11 70317856 missense probably benign 0.18
R1996:Alox12e UTSW 11 70316208 missense probably benign 0.00
R2062:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2063:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2067:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2068:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2147:Alox12e UTSW 11 70319945 missense probably damaging 1.00
R2307:Alox12e UTSW 11 70321261 missense probably damaging 1.00
R3034:Alox12e UTSW 11 70316253 missense probably benign 0.01
R4463:Alox12e UTSW 11 70318256 missense probably damaging 1.00
R4572:Alox12e UTSW 11 70321181 intron probably benign
R5004:Alox12e UTSW 11 70321504 missense probably benign 0.00
R5113:Alox12e UTSW 11 70315995 missense possibly damaging 0.70
R5155:Alox12e UTSW 11 70316255 missense possibly damaging 0.61
R5464:Alox12e UTSW 11 70317679 missense probably damaging 0.99
R5471:Alox12e UTSW 11 70320024 missense probably benign 0.17
R5501:Alox12e UTSW 11 70316229 missense probably benign 0.01
R5915:Alox12e UTSW 11 70318224 missense possibly damaging 0.81
R6033:Alox12e UTSW 11 70316013 missense probably benign 0.03
R6033:Alox12e UTSW 11 70316013 missense probably benign 0.03
R6102:Alox12e UTSW 11 70320023 missense possibly damaging 0.65
R6380:Alox12e UTSW 11 70321101 missense probably benign 0.00
R6452:Alox12e UTSW 11 70320005 missense probably damaging 0.96
R7175:Alox12e UTSW 11 70319708 missense probably damaging 1.00
R7220:Alox12e UTSW 11 70315905 missense probably benign 0.02
R7353:Alox12e UTSW 11 70321435 missense probably damaging 1.00
R7542:Alox12e UTSW 11 70321756 missense possibly damaging 0.69
R7916:Alox12e UTSW 11 70321285 missense probably benign
R8314:Alox12e UTSW 11 70316172 missense possibly damaging 0.83
R8331:Alox12e UTSW 11 70321097 missense probably benign 0.01
R9027:Alox12e UTSW 11 70321774 missense possibly damaging 0.68
R9380:Alox12e UTSW 11 70316168 critical splice donor site probably null
R9641:Alox12e UTSW 11 70321435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCCTCATTGTGGCCACAG -3'
(R):5'- ATTTCTCCCTGCTGGATGGAG -3'

Sequencing Primer
(F):5'- TTGTGGCCACAGAAATAACCTCG -3'
(R):5'- CTGCTGGATGGAGTCAAACCTAAC -3'
Posted On 2015-03-18