Mutagenetix > Incidental Mutation

Incidental Mutation 'R3739:Mybbp1a'

270303

Institutional Source

Beutler Lab

Gene Symbol

Mybbp1a

Ensembl Gene

ENSMUSG00000040463

Gene Name

MYB binding protein (P160) 1a

Synonyms

p160MBP, p67MBP

MMRRC Submission

040725-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3739 (G1)

Quality Score

123

Status

Validated

Chromosome

Chromosomal Location

72441355-72451768 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72448737 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 882 (H882R)

Ref Sequence

ENSEMBL: ENSMUSP00000044827 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045303] [ENSMUST00000045633]

AlphaFold

Q7TPV4

Predicted Effect

probably benign
Transcript: ENSMUST00000045303

SMART Domains

Protein: ENSMUSP00000044418
Gene: ENSMUSG00000040447

Domain	Start	End	E-Value	Type
low complexity region	5	53	N/A	INTRINSIC
Pfam:Sugar_tr	104	308	7.6e-16	PFAM
Pfam:OATP	106	427	7.2e-13	PFAM
Pfam:MFS_1	108	476	2.7e-37	PFAM
transmembrane domain	506	528	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045633
AA Change: H882R

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463
AA Change: H882R

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
Pfam:DNA_pol_phi	70	835	1.2e-194	PFAM
low complexity region	839	852	N/A	INTRINSIC
low complexity region	1080	1090	N/A	INTRINSIC
low complexity region	1109	1122	N/A	INTRINSIC
low complexity region	1259	1269	N/A	INTRINSIC
low complexity region	1314	1329	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126452

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129274

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134119

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144374

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144923

Predicted Effect

probably benign
Transcript: ENSMUST00000144940

SMART Domains

Protein: ENSMUSP00000120722
Gene: ENSMUSG00000040447

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
transmembrane domain	37	59	N/A	INTRINSIC
transmembrane domain	80	102	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150491

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152894

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155995

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162048

Meta Mutation Damage Score

0.3187

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

98% (49/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar transcriptional regulator that was first identified by its ability to bind specifically to the Myb proto-oncogene protein. The encoded protein is thought to play a role in many cellular processes including response to nucleolar stress, tumor suppression and synthesis of ribosomal DNA. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality before blastocyst formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik2	A	T	11: 49,019,281	L775*	probably null	Het
Abcb8	A	G	5: 24,400,621	S168G	probably benign	Het
Ahnak2	T	C	12: 112,774,558	I1027V	probably benign	Het
Alox12e	A	G	11: 70,319,842	L318P	probably damaging	Het
Ankrd11	A	G	8: 122,896,715		probably benign	Het
Anks1b	T	A	10: 90,033,216	I46N	probably damaging	Het
Apoa5	G	C	9: 46,269,117	W7S	probably damaging	Het
Arnt2	T	C	7: 84,343,801	H177R	probably null	Het
Cacna1c	T	C	6: 118,741,952	D220G	probably benign	Het
Dst	C	T	1: 34,268,894		probably benign	Het
Eml6	C	A	11: 29,803,137	V925L	probably benign	Het
Fbll1	G	A	11: 35,797,678	H253Y	possibly damaging	Het
Galnt1	A	G	18: 24,271,655	T350A	probably benign	Het
Gbp10	T	A	5: 105,224,458	E145D	possibly damaging	Het
Gfm1	T	C	3: 67,456,700	I503T	probably damaging	Het
Hmcn2	A	T	2: 31,336,612	K200*	probably null	Het
Ifi203	T	A	1: 173,929,474		probably benign	Het
Itgbl1	T	C	14: 123,966,678	F394L	probably damaging	Het
Itpkc	T	A	7: 27,227,604	D295V	possibly damaging	Het
Klra17	T	A	6: 129,873,365	I41F	probably benign	Het
Lcorl	A	T	5: 45,734,041	N323K	possibly damaging	Het
Ltbp2	A	T	12: 84,804,474	C836S	probably damaging	Het
Mfsd2b	A	G	12: 4,870,578	S80P	probably damaging	Het
Ms4a18	A	T	19: 11,011,499	H164Q	probably damaging	Het
Myh9	G	A	15: 77,766,812	R1612C	probably damaging	Het
Myo18a	A	G	11: 77,845,615	D1514G	probably damaging	Het
Nsun2	T	C	13: 69,629,638	I441T	probably benign	Het
Ntng1	A	T	3: 109,934,691	D255E	probably damaging	Het
Olfr1385	A	G	11: 49,495,460	D309G	possibly damaging	Het
Osbpl2	G	A	2: 180,161,560	R475H	probably damaging	Het
Pclo	A	C	5: 14,680,899	K3138N	unknown	Het
Pcsk7	A	G	9: 45,926,759	T572A	possibly damaging	Het
Pex11a	C	T	7: 79,740,170	R56H	possibly damaging	Het
Pnmal2	C	T	7: 16,946,596	H502Y	probably benign	Het
Saa4	T	A	7: 46,729,629	N96Y	possibly damaging	Het
Serpinb6d	T	A	13: 33,667,680	V140E	probably damaging	Het
Srsf4	C	T	4: 131,900,102		probably benign	Het
St18	G	A	1: 6,855,473		probably null	Het
Taf3	T	C	2: 9,951,658	E566G	possibly damaging	Het
Tnr	T	C	1: 159,923,413	S1315P	possibly damaging	Het
Trappc11	T	C	8: 47,514,103	E412G	probably damaging	Het
Trpc2	G	A	7: 102,084,504	S220N	probably damaging	Het
Trpm7	A	G	2: 126,851,521	V48A	probably damaging	Het
Tubb6	A	G	18: 67,402,051	Y340C	probably damaging	Het
Vmn1r197	C	A	13: 22,328,576	Y222*	probably null	Het
Vmn2r97	T	C	17: 18,928,151	S103P	probably damaging	Het
Zfp362	C	G	4: 128,786,889		probably benign	Het
Zfp423	A	G	8: 87,781,344	C666R	probably damaging	Het

Other mutations in Mybbp1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00924:Mybbp1a	APN	11	72443567	missense	probably damaging	1.00
IGL03240:Mybbp1a	APN	11	72445666	missense	possibly damaging	0.95
IGL03271:Mybbp1a	APN	11	72443918	splice site	probably benign
IGL03344:Mybbp1a	APN	11	72445202	missense	probably damaging	1.00
fratelli	UTSW	11	72445712	missense	probably benign	0.02
primi	UTSW	11	72442901	splice site	probably null
sorelli	UTSW	11	72447759	missense	possibly damaging	0.94
R0276:Mybbp1a	UTSW	11	72450107	splice site	probably null
R0437:Mybbp1a	UTSW	11	72448848	missense	possibly damaging	0.75
R0551:Mybbp1a	UTSW	11	72448376	missense	probably benign	0.06
R1394:Mybbp1a	UTSW	11	72443648	missense	probably damaging	1.00
R1667:Mybbp1a	UTSW	11	72445217	missense	probably benign	0.00
R1888:Mybbp1a	UTSW	11	72446037	missense	probably benign	0.18
R1888:Mybbp1a	UTSW	11	72446037	missense	probably benign	0.18
R1891:Mybbp1a	UTSW	11	72446037	missense	probably benign	0.18
R1894:Mybbp1a	UTSW	11	72446037	missense	probably benign	0.18
R2074:Mybbp1a	UTSW	11	72441445	missense	probably benign	0.01
R2257:Mybbp1a	UTSW	11	72446195	missense	probably benign	0.10
R3983:Mybbp1a	UTSW	11	72447170	missense	probably damaging	1.00
R4191:Mybbp1a	UTSW	11	72451287	missense	probably damaging	0.97
R4660:Mybbp1a	UTSW	11	72445712	missense	probably benign	0.02
R4667:Mybbp1a	UTSW	11	72447971	missense	possibly damaging	0.94
R4769:Mybbp1a	UTSW	11	72445640	missense	probably damaging	1.00
R4982:Mybbp1a	UTSW	11	72445214	missense	probably damaging	0.99
R5451:Mybbp1a	UTSW	11	72448113	missense	probably damaging	0.99
R5514:Mybbp1a	UTSW	11	72450636	missense	possibly damaging	0.61
R5548:Mybbp1a	UTSW	11	72446172	missense	probably damaging	1.00
R5673:Mybbp1a	UTSW	11	72444925	missense	probably benign	0.30
R5947:Mybbp1a	UTSW	11	72442431	missense	probably damaging	1.00
R6161:Mybbp1a	UTSW	11	72446012	missense	probably damaging	1.00
R6785:Mybbp1a	UTSW	11	72447566	missense	probably benign	0.00
R7154:Mybbp1a	UTSW	11	72447642	splice site	probably null
R7227:Mybbp1a	UTSW	11	72447759	missense	possibly damaging	0.94
R7238:Mybbp1a	UTSW	11	72443512	missense	probably damaging	1.00
R7441:Mybbp1a	UTSW	11	72451275	missense	probably benign	0.01
R7833:Mybbp1a	UTSW	11	72442901	splice site	probably null
R8213:Mybbp1a	UTSW	11	72444721	missense	probably damaging	1.00
R8324:Mybbp1a	UTSW	11	72445288	critical splice donor site	probably null
R8474:Mybbp1a	UTSW	11	72447737	missense	probably benign	0.01
R8972:Mybbp1a	UTSW	11	72446250	missense	probably benign	0.35
R9018:Mybbp1a	UTSW	11	72443594	missense	probably benign	0.09
R9380:Mybbp1a	UTSW	11	72442842	missense	probably benign	0.24
R9505:Mybbp1a	UTSW	11	72449071	missense	probably benign	0.26
X0050:Mybbp1a	UTSW	11	72441677	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACTTTACAGAGGCCAGAAGC -3'
(R):5'- AGCTCCGTGTAACTTATGACC -3'

Sequencing Primer
(F):5'- TGTCCCACAAGACAGATACACGTAG -3'
(R):5'- CGTGTAACTTATGACCATCTTGG -3'

Posted On

2015-03-18