Incidental Mutation 'R3739:Mybbp1a'
ID 270303
Institutional Source Beutler Lab
Gene Symbol Mybbp1a
Ensembl Gene ENSMUSG00000040463
Gene Name MYB binding protein (P160) 1a
Synonyms p67MBP, p160MBP
MMRRC Submission 040725-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3739 (G1)
Quality Score 123
Status Validated
Chromosome 11
Chromosomal Location 72332181-72342594 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 72339563 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 882 (H882R)
Ref Sequence ENSEMBL: ENSMUSP00000044827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045303] [ENSMUST00000045633]
AlphaFold Q7TPV4
Predicted Effect probably benign
Transcript: ENSMUST00000045303
SMART Domains Protein: ENSMUSP00000044418
Gene: ENSMUSG00000040447

DomainStartEndE-ValueType
low complexity region 5 53 N/A INTRINSIC
Pfam:Sugar_tr 104 308 7.6e-16 PFAM
Pfam:OATP 106 427 7.2e-13 PFAM
Pfam:MFS_1 108 476 2.7e-37 PFAM
transmembrane domain 506 528 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000045633
AA Change: H882R

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463
AA Change: H882R

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:DNA_pol_phi 70 835 1.2e-194 PFAM
low complexity region 839 852 N/A INTRINSIC
low complexity region 1080 1090 N/A INTRINSIC
low complexity region 1109 1122 N/A INTRINSIC
low complexity region 1259 1269 N/A INTRINSIC
low complexity region 1314 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155995
Predicted Effect probably benign
Transcript: ENSMUST00000144940
SMART Domains Protein: ENSMUSP00000120722
Gene: ENSMUSG00000040447

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Meta Mutation Damage Score 0.3187 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar transcriptional regulator that was first identified by its ability to bind specifically to the Myb proto-oncogene protein. The encoded protein is thought to play a role in many cellular processes including response to nucleolar stress, tumor suppression and synthesis of ribosomal DNA. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality before blastocyst formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 48,910,108 (GRCm39) L775* probably null Het
Abcb8 A G 5: 24,605,619 (GRCm39) S168G probably benign Het
Ahnak2 T C 12: 112,740,992 (GRCm39) I1027V probably benign Het
Alox12e A G 11: 70,210,668 (GRCm39) L318P probably damaging Het
Ankrd11 A G 8: 123,623,454 (GRCm39) probably benign Het
Anks1b T A 10: 89,869,078 (GRCm39) I46N probably damaging Het
Apoa5 G C 9: 46,180,415 (GRCm39) W7S probably damaging Het
Arnt2 T C 7: 83,993,009 (GRCm39) H177R probably null Het
Cacna1c T C 6: 118,718,913 (GRCm39) D220G probably benign Het
Dst C T 1: 34,307,975 (GRCm39) probably benign Het
Eml6 C A 11: 29,753,137 (GRCm39) V925L probably benign Het
Fbll1 G A 11: 35,688,505 (GRCm39) H253Y possibly damaging Het
Galnt1 A G 18: 24,404,712 (GRCm39) T350A probably benign Het
Gbp10 T A 5: 105,372,324 (GRCm39) E145D possibly damaging Het
Gfm1 T C 3: 67,364,033 (GRCm39) I503T probably damaging Het
Hmcn2 A T 2: 31,226,624 (GRCm39) K200* probably null Het
Ifi203 T A 1: 173,757,040 (GRCm39) probably benign Het
Itgbl1 T C 14: 124,204,090 (GRCm39) F394L probably damaging Het
Itpkc T A 7: 26,927,029 (GRCm39) D295V possibly damaging Het
Klra17 T A 6: 129,850,328 (GRCm39) I41F probably benign Het
Lcorl A T 5: 45,891,383 (GRCm39) N323K possibly damaging Het
Ltbp2 A T 12: 84,851,248 (GRCm39) C836S probably damaging Het
Mfsd2b A G 12: 4,920,578 (GRCm39) S80P probably damaging Het
Ms4a18 A T 19: 10,988,863 (GRCm39) H164Q probably damaging Het
Myh9 G A 15: 77,651,012 (GRCm39) R1612C probably damaging Het
Myo18a A G 11: 77,736,441 (GRCm39) D1514G probably damaging Het
Nsun2 T C 13: 69,777,757 (GRCm39) I441T probably benign Het
Ntng1 A T 3: 109,842,007 (GRCm39) D255E probably damaging Het
Or2y1 A G 11: 49,386,287 (GRCm39) D309G possibly damaging Het
Osbpl2 G A 2: 179,803,353 (GRCm39) R475H probably damaging Het
Pclo A C 5: 14,730,913 (GRCm39) K3138N unknown Het
Pcsk7 A G 9: 45,838,057 (GRCm39) T572A possibly damaging Het
Pex11a C T 7: 79,389,918 (GRCm39) R56H possibly damaging Het
Pnma8b C T 7: 16,680,521 (GRCm39) H502Y probably benign Het
Saa4 T A 7: 46,379,053 (GRCm39) N96Y possibly damaging Het
Serpinb6d T A 13: 33,851,663 (GRCm39) V140E probably damaging Het
Srsf4 C T 4: 131,627,413 (GRCm39) probably benign Het
St18 G A 1: 6,925,697 (GRCm39) probably null Het
Taf3 T C 2: 9,956,469 (GRCm39) E566G possibly damaging Het
Tnr T C 1: 159,750,983 (GRCm39) S1315P possibly damaging Het
Trappc11 T C 8: 47,967,138 (GRCm39) E412G probably damaging Het
Trpc2 G A 7: 101,733,711 (GRCm39) S220N probably damaging Het
Trpm7 A G 2: 126,693,441 (GRCm39) V48A probably damaging Het
Tubb6 A G 18: 67,535,121 (GRCm39) Y340C probably damaging Het
Vmn1r197 C A 13: 22,512,746 (GRCm39) Y222* probably null Het
Vmn2r97 T C 17: 19,148,413 (GRCm39) S103P probably damaging Het
Zfp362 C G 4: 128,680,682 (GRCm39) probably benign Het
Zfp423 A G 8: 88,507,972 (GRCm39) C666R probably damaging Het
Other mutations in Mybbp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Mybbp1a APN 11 72,334,393 (GRCm39) missense probably damaging 1.00
IGL03240:Mybbp1a APN 11 72,336,492 (GRCm39) missense possibly damaging 0.95
IGL03271:Mybbp1a APN 11 72,334,744 (GRCm39) splice site probably benign
IGL03344:Mybbp1a APN 11 72,336,028 (GRCm39) missense probably damaging 1.00
fratelli UTSW 11 72,336,538 (GRCm39) missense probably benign 0.02
primi UTSW 11 72,333,727 (GRCm39) splice site probably null
sorelli UTSW 11 72,338,585 (GRCm39) missense possibly damaging 0.94
R0276:Mybbp1a UTSW 11 72,340,933 (GRCm39) splice site probably null
R0437:Mybbp1a UTSW 11 72,339,674 (GRCm39) missense possibly damaging 0.75
R0551:Mybbp1a UTSW 11 72,339,202 (GRCm39) missense probably benign 0.06
R1394:Mybbp1a UTSW 11 72,334,474 (GRCm39) missense probably damaging 1.00
R1667:Mybbp1a UTSW 11 72,336,043 (GRCm39) missense probably benign 0.00
R1888:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R1888:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R1891:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R1894:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R2074:Mybbp1a UTSW 11 72,332,271 (GRCm39) missense probably benign 0.01
R2257:Mybbp1a UTSW 11 72,337,021 (GRCm39) missense probably benign 0.10
R3983:Mybbp1a UTSW 11 72,337,996 (GRCm39) missense probably damaging 1.00
R4191:Mybbp1a UTSW 11 72,342,113 (GRCm39) missense probably damaging 0.97
R4660:Mybbp1a UTSW 11 72,336,538 (GRCm39) missense probably benign 0.02
R4667:Mybbp1a UTSW 11 72,338,797 (GRCm39) missense possibly damaging 0.94
R4769:Mybbp1a UTSW 11 72,336,466 (GRCm39) missense probably damaging 1.00
R4982:Mybbp1a UTSW 11 72,336,040 (GRCm39) missense probably damaging 0.99
R5451:Mybbp1a UTSW 11 72,338,939 (GRCm39) missense probably damaging 0.99
R5514:Mybbp1a UTSW 11 72,341,462 (GRCm39) missense possibly damaging 0.61
R5548:Mybbp1a UTSW 11 72,336,998 (GRCm39) missense probably damaging 1.00
R5673:Mybbp1a UTSW 11 72,335,751 (GRCm39) missense probably benign 0.30
R5947:Mybbp1a UTSW 11 72,333,257 (GRCm39) missense probably damaging 1.00
R6161:Mybbp1a UTSW 11 72,336,838 (GRCm39) missense probably damaging 1.00
R6785:Mybbp1a UTSW 11 72,338,392 (GRCm39) missense probably benign 0.00
R7154:Mybbp1a UTSW 11 72,338,468 (GRCm39) splice site probably null
R7227:Mybbp1a UTSW 11 72,338,585 (GRCm39) missense possibly damaging 0.94
R7238:Mybbp1a UTSW 11 72,334,338 (GRCm39) missense probably damaging 1.00
R7441:Mybbp1a UTSW 11 72,342,101 (GRCm39) missense probably benign 0.01
R7833:Mybbp1a UTSW 11 72,333,727 (GRCm39) splice site probably null
R8213:Mybbp1a UTSW 11 72,335,547 (GRCm39) missense probably damaging 1.00
R8324:Mybbp1a UTSW 11 72,336,114 (GRCm39) critical splice donor site probably null
R8474:Mybbp1a UTSW 11 72,338,563 (GRCm39) missense probably benign 0.01
R8972:Mybbp1a UTSW 11 72,337,076 (GRCm39) missense probably benign 0.35
R9018:Mybbp1a UTSW 11 72,334,420 (GRCm39) missense probably benign 0.09
R9380:Mybbp1a UTSW 11 72,333,668 (GRCm39) missense probably benign 0.24
R9505:Mybbp1a UTSW 11 72,339,897 (GRCm39) missense probably benign 0.26
X0050:Mybbp1a UTSW 11 72,332,503 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTTTACAGAGGCCAGAAGC -3'
(R):5'- AGCTCCGTGTAACTTATGACC -3'

Sequencing Primer
(F):5'- TGTCCCACAAGACAGATACACGTAG -3'
(R):5'- CGTGTAACTTATGACCATCTTGG -3'
Posted On 2015-03-18