Incidental Mutation 'R3740:Optn'
ID270324
Institutional Source Beutler Lab
Gene Symbol Optn
Ensembl Gene ENSMUSG00000026672
Gene Nameoptineurin
SynonymsTFIIIA-INTP, 4930441O07Rik
MMRRC Submission 040726-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R3740 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location5020642-5064051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 5034198 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 371 (M371I)
Ref Sequence ENSEMBL: ENSMUSP00000110648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027986] [ENSMUST00000114996]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027986
AA Change: M371I

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027986
Gene: ENSMUSG00000026672
AA Change: M371I

DomainStartEndE-ValueType
Pfam:NEMO 37 104 2e-27 PFAM
coiled coil region 243 278 N/A INTRINSIC
PDB:2ZVO|D 424 512 2e-11 PDB
PDB:2LO4|A 551 584 4e-15 PDB
Blast:ZnF_C2H2 560 580 2e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000114996
AA Change: M371I

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110648
Gene: ENSMUSG00000026672
AA Change: M371I

DomainStartEndE-ValueType
Pfam:NEMO 37 104 2e-27 PFAM
coiled coil region 243 278 N/A INTRINSIC
Pfam:CC2-LZ 407 510 3.2e-33 PFAM
PDB:2LO4|A 551 584 4e-15 PDB
Blast:ZnF_C2H2 560 580 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145585
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 94% (29/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the coiled-coil containing protein optineurin. Optineurin may play a role in normal-tension glaucoma and adult-onset primary open angle glaucoma. Optineurin interacts with adenovirus E3-14.7K protein and may utilize tumor necrosis factor-alpha or Fas-ligand pathways to mediate apoptosis, inflammation or vasoconstriction. Optineurin may also function in cellular morphogenesis and membrane trafficking, vesicle trafficking, and transcription activation through its interactions with the RAB8, huntingtin, and transcription factor IIIA proteins. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice hypomorphic allele exhibit background sensitive embryonic lethality with surviving mice exhibiting normal immune cell development, T and B cell activation and TNF- or LPS-mediated activation of cells of the innate immune system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,826,454 R103G probably benign Het
Atp8b2 C G 3: 89,946,031 A726P probably benign Het
Bbox1 A G 2: 110,305,577 I19T possibly damaging Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fam135a A T 1: 24,014,811 M1215K probably damaging Het
Fam174b T C 7: 73,740,830 probably null Het
Fgfr1op2 A G 6: 146,595,233 I190V possibly damaging Het
Flt1 G A 5: 147,599,593 R813W probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Hacd3 T C 9: 65,021,473 E24G possibly damaging Het
Kat6b T G 14: 21,670,044 M1488R probably damaging Het
Kcnk3 T C 5: 30,621,930 V108A possibly damaging Het
Kif5a A G 10: 127,243,468 I287T probably damaging Het
Mical1 A C 10: 41,479,071 D192A probably benign Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Pik3cg T C 12: 32,205,224 K255E probably damaging Het
Rims1 A T 1: 22,373,443 V380D probably damaging Het
Serpinb6e T A 13: 33,838,960 I147F probably benign Het
Slc13a1 T C 6: 24,134,477 M136V probably damaging Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tiam2 A G 17: 3,414,113 D39G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Ttn T A 2: 76,790,359 K13995* probably null Het
Vmn1r225 A G 17: 20,502,999 Q234R possibly damaging Het
Vmn2r107 A G 17: 20,374,889 N568S probably benign Het
Zfp605 G T 5: 110,128,698 G561W probably damaging Het
Zfp69 T A 4: 120,930,874 probably null Het
Other mutations in Optn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Optn APN 2 5033156 missense possibly damaging 0.93
IGL01433:Optn APN 2 5027144 missense probably benign 0.07
IGL01480:Optn APN 2 5046018 missense probably benign 0.01
IGL01863:Optn APN 2 5021487 splice site probably benign
IGL02108:Optn APN 2 5031273 missense possibly damaging 0.91
IGL02150:Optn APN 2 5033152 missense probably damaging 0.97
IGL02623:Optn APN 2 5035022 missense probably damaging 1.00
R0119:Optn UTSW 2 5024115 missense probably damaging 1.00
R0121:Optn UTSW 2 5024115 missense probably damaging 1.00
R0330:Optn UTSW 2 5034255 missense possibly damaging 0.53
R0332:Optn UTSW 2 5024115 missense probably damaging 1.00
R0335:Optn UTSW 2 5024115 missense probably damaging 1.00
R0390:Optn UTSW 2 5046195 missense probably benign
R0437:Optn UTSW 2 5024115 missense probably damaging 1.00
R1710:Optn UTSW 2 5053130 missense possibly damaging 0.90
R2229:Optn UTSW 2 5024117 missense probably damaging 1.00
R3237:Optn UTSW 2 5034203 missense probably damaging 1.00
R3741:Optn UTSW 2 5034198 missense possibly damaging 0.51
R4667:Optn UTSW 2 5033139 missense probably benign 0.20
R4783:Optn UTSW 2 5054627 missense probably benign
R4965:Optn UTSW 2 5021379 missense probably benign 0.14
R5121:Optn UTSW 2 5046106 missense probably benign 0.25
R6119:Optn UTSW 2 5021323 splice site probably null
R7024:Optn UTSW 2 5052837 splice site probably null
R7167:Optn UTSW 2 5042483 missense probably benign 0.00
R7685:Optn UTSW 2 5054650 missense probably benign 0.01
R8103:Optn UTSW 2 5040202 missense probably damaging 0.97
R8267:Optn UTSW 2 5054651 missense probably benign 0.00
R8844:Optn UTSW 2 5027112 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCTAGACATCTAGTTTCCAGATG -3'
(R):5'- TTTGTGCAGAAGCCAGGGAG -3'

Sequencing Primer
(F):5'- AGATTTTATGCCATGACTCCCAGG -3'
(R):5'- CCAGGGAGAGTGACAAAGTGTTG -3'
Posted On2015-03-18