Incidental Mutation 'R3740:Bbox1'
ID270326
Institutional Source Beutler Lab
Gene Symbol Bbox1
Ensembl Gene ENSMUSG00000041660
Gene Namebutyrobetaine (gamma), 2-oxoglutarate dioxygenase 1 (gamma-butyrobetaine hydroxylase)
Synonyms
MMRRC Submission 040726-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3740 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location110262697-110314560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110305577 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 19 (I19T)
Ref Sequence ENSEMBL: ENSMUSP00000116663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046233] [ENSMUST00000133608]
Predicted Effect probably benign
Transcript: ENSMUST00000046233
AA Change: I19T

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046302
Gene: ENSMUSG00000041660
AA Change: I19T

DomainStartEndE-ValueType
Pfam:DUF971 9 91 6.7e-15 PFAM
Pfam:TauD 109 366 6.9e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000133608
AA Change: I19T

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116663
Gene: ENSMUSG00000041660
AA Change: I19T

DomainStartEndE-ValueType
Pfam:DUF971 7 68 1.2e-8 PFAM
Meta Mutation Damage Score 0.6613 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 94% (29/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes gamma butyrobetaine hydroxylase which catalyzes the formation of L-carnitine from gamma-butyrobetaine, the last step in the L-carnitine biosynthetic pathway. Carnitine is essential for the transport of activated fatty acids across the mitochondrial membrane during mitochondrial beta-oxidation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,826,454 R103G probably benign Het
Atp8b2 C G 3: 89,946,031 A726P probably benign Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fam135a A T 1: 24,014,811 M1215K probably damaging Het
Fam174b T C 7: 73,740,830 probably null Het
Fgfr1op2 A G 6: 146,595,233 I190V possibly damaging Het
Flt1 G A 5: 147,599,593 R813W probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Hacd3 T C 9: 65,021,473 E24G possibly damaging Het
Kat6b T G 14: 21,670,044 M1488R probably damaging Het
Kcnk3 T C 5: 30,621,930 V108A possibly damaging Het
Kif5a A G 10: 127,243,468 I287T probably damaging Het
Mical1 A C 10: 41,479,071 D192A probably benign Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Optn C A 2: 5,034,198 M371I possibly damaging Het
Pik3cg T C 12: 32,205,224 K255E probably damaging Het
Rims1 A T 1: 22,373,443 V380D probably damaging Het
Serpinb6e T A 13: 33,838,960 I147F probably benign Het
Slc13a1 T C 6: 24,134,477 M136V probably damaging Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tiam2 A G 17: 3,414,113 D39G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Ttn T A 2: 76,790,359 K13995* probably null Het
Vmn1r225 A G 17: 20,502,999 Q234R possibly damaging Het
Vmn2r107 A G 17: 20,374,889 N568S probably benign Het
Zfp605 G T 5: 110,128,698 G561W probably damaging Het
Zfp69 T A 4: 120,930,874 probably null Het
Other mutations in Bbox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Bbox1 APN 2 110265486 missense probably benign 0.06
IGL02273:Bbox1 APN 2 110275616 nonsense probably null
IGL02648:Bbox1 APN 2 110305526 missense probably damaging 1.00
E0374:Bbox1 UTSW 2 110268311 missense probably damaging 1.00
PIT4434001:Bbox1 UTSW 2 110275634 missense probably benign 0.01
R0047:Bbox1 UTSW 2 110268302 missense probably damaging 1.00
R0047:Bbox1 UTSW 2 110268302 missense probably damaging 1.00
R1173:Bbox1 UTSW 2 110265611 missense probably damaging 0.99
R1682:Bbox1 UTSW 2 110292548 missense possibly damaging 0.46
R2510:Bbox1 UTSW 2 110305631 start codon destroyed probably null 1.00
R3741:Bbox1 UTSW 2 110305577 missense possibly damaging 0.79
R4125:Bbox1 UTSW 2 110270180 missense probably benign
R4126:Bbox1 UTSW 2 110270180 missense probably benign
R4128:Bbox1 UTSW 2 110270180 missense probably benign
R4750:Bbox1 UTSW 2 110265521 missense possibly damaging 0.93
R4841:Bbox1 UTSW 2 110303739 splice site probably null
R5621:Bbox1 UTSW 2 110292523 nonsense probably null
R6210:Bbox1 UTSW 2 110270077 missense probably benign 0.38
R6649:Bbox1 UTSW 2 110305569 missense probably benign
R6677:Bbox1 UTSW 2 110305425 missense probably damaging 1.00
R7078:Bbox1 UTSW 2 110292539 missense probably benign
R7473:Bbox1 UTSW 2 110265498 missense probably damaging 1.00
R7590:Bbox1 UTSW 2 110268232 missense probably benign
R7672:Bbox1 UTSW 2 110305449 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGGAAGAGCATTTAGACGTAATTACC -3'
(R):5'- AACTGTAGGCTCACACTGCTG -3'

Sequencing Primer
(F):5'- CGTAATTACCTTTTTCCGGTCAAATG -3'
(R):5'- CAGAGGCCAGAGTCCACTTG -3'
Posted On2015-03-18