Incidental Mutation 'R3740:Ctso'
ID270328
Institutional Source Beutler Lab
Gene Symbol Ctso
Ensembl Gene ENSMUSG00000028015
Gene Namecathepsin O
Synonyms
MMRRC Submission 040726-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3740 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location81932601-81956725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81952249 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 288 (V288I)
Ref Sequence ENSEMBL: ENSMUSP00000029649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029645] [ENSMUST00000029649]
Predicted Effect probably benign
Transcript: ENSMUST00000029645
SMART Domains Protein: ENSMUSP00000029645
Gene: ENSMUSG00000028011

DomainStartEndE-ValueType
Pfam:Trp_dioxygenase 26 372 8e-177 PFAM
low complexity region 393 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029649
AA Change: V288I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029649
Gene: ENSMUSG00000028015
AA Change: V288I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pept_C1 99 311 2.21e-69 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155144
Meta Mutation Damage Score 0.3424 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 94% (29/31)
MGI Phenotype FUNCTION: This gene encodes a member of the cathepsin family of cysteine proteases that are involved in the degradation of cellular proteins. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional enzyme. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,826,454 R103G probably benign Het
Atp8b2 C G 3: 89,946,031 A726P probably benign Het
Bbox1 A G 2: 110,305,577 I19T possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fam135a A T 1: 24,014,811 M1215K probably damaging Het
Fam174b T C 7: 73,740,830 probably null Het
Fgfr1op2 A G 6: 146,595,233 I190V possibly damaging Het
Flt1 G A 5: 147,599,593 R813W probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Hacd3 T C 9: 65,021,473 E24G possibly damaging Het
Kat6b T G 14: 21,670,044 M1488R probably damaging Het
Kcnk3 T C 5: 30,621,930 V108A possibly damaging Het
Kif5a A G 10: 127,243,468 I287T probably damaging Het
Mical1 A C 10: 41,479,071 D192A probably benign Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Optn C A 2: 5,034,198 M371I possibly damaging Het
Pik3cg T C 12: 32,205,224 K255E probably damaging Het
Rims1 A T 1: 22,373,443 V380D probably damaging Het
Serpinb6e T A 13: 33,838,960 I147F probably benign Het
Slc13a1 T C 6: 24,134,477 M136V probably damaging Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tiam2 A G 17: 3,414,113 D39G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Ttn T A 2: 76,790,359 K13995* probably null Het
Vmn1r225 A G 17: 20,502,999 Q234R possibly damaging Het
Vmn2r107 A G 17: 20,374,889 N568S probably benign Het
Zfp605 G T 5: 110,128,698 G561W probably damaging Het
Zfp69 T A 4: 120,930,874 probably null Het
Other mutations in Ctso
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02619:Ctso APN 3 81941529 splice site probably benign
IGL02696:Ctso APN 3 81951384 missense possibly damaging 0.63
R0309:Ctso UTSW 3 81944861 critical splice acceptor site probably null
R0357:Ctso UTSW 3 81951543 splice site probably benign
R2511:Ctso UTSW 3 81932734 missense probably damaging 0.97
R3741:Ctso UTSW 3 81952249 missense probably benign 0.00
R3742:Ctso UTSW 3 81952249 missense probably benign 0.00
R4771:Ctso UTSW 3 81932740 missense probably benign
R4801:Ctso UTSW 3 81954240 missense probably damaging 0.99
R4802:Ctso UTSW 3 81954240 missense probably damaging 0.99
R4875:Ctso UTSW 3 81942381 intron probably benign
R5891:Ctso UTSW 3 81954254 missense probably benign 0.02
R6755:Ctso UTSW 3 81942302 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTTATGGAGCTGCCTGCAG -3'
(R):5'- TCTGGGGAAGTTTAATAACCTAGATGG -3'

Sequencing Primer
(F):5'- GAGCTGCCTGCAGAAAATAATTTGC -3'
(R):5'- TTTCTCATTAACAGGATAAGCAACC -3'
Posted On2015-03-18