Incidental Mutation 'R3740:Atp8b2'
ID270329
Institutional Source Beutler Lab
Gene Symbol Atp8b2
Ensembl Gene ENSMUSG00000060671
Gene NameATPase, class I, type 8B, member 2
SynonymsId
MMRRC Submission 040726-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R3740 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89939481-89963508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 89946031 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Proline at position 726 (A726P)
Ref Sequence ENSEMBL: ENSMUSP00000128423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069805] [ENSMUST00000107396] [ENSMUST00000166502] [ENSMUST00000168276] [ENSMUST00000170739]
Predicted Effect probably benign
Transcript: ENSMUST00000069805
AA Change: A745P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063384
Gene: ENSMUSG00000060671
AA Change: A745P

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
low complexity region 80 96 N/A INTRINSIC
Pfam:E1-E2_ATPase 103 374 5.6e-18 PFAM
Pfam:HAD 408 842 1.3e-17 PFAM
Pfam:Hydrolase_like2 491 590 1e-11 PFAM
Pfam:Hydrolase 590 845 7.9e-8 PFAM
low complexity region 1133 1147 N/A INTRINSIC
low complexity region 1167 1190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107396
AA Change: A750P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103019
Gene: ENSMUSG00000060671
AA Change: A750P

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 1.3e-29 PFAM
Pfam:E1-E2_ATPase 81 351 2.7e-9 PFAM
Pfam:HAD 389 847 1.5e-17 PFAM
Pfam:Cation_ATPase 472 571 4.3e-12 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2e-84 PFAM
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1172 1195 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166347
Predicted Effect probably benign
Transcript: ENSMUST00000166502
SMART Domains Protein: ENSMUSP00000132201
Gene: ENSMUSG00000060671

DomainStartEndE-ValueType
SCOP:d1eula_ 2 95 5e-7 SMART
low complexity region 100 109 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167442
Predicted Effect probably benign
Transcript: ENSMUST00000168276
AA Change: A726P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128423
Gene: ENSMUSG00000060671
AA Change: A726P

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:E1-E2_ATPase 84 355 2.5e-18 PFAM
Pfam:HAD 389 823 7.9e-18 PFAM
Pfam:Hydrolase_like2 472 571 3.6e-12 PFAM
Pfam:Hydrolase 571 826 6.5e-8 PFAM
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1148 1171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170324
Predicted Effect probably benign
Transcript: ENSMUST00000170739
SMART Domains Protein: ENSMUSP00000127720
Gene: ENSMUSG00000060671

DomainStartEndE-ValueType
Pfam:Hydrolase_like2 1 82 1.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171818
Predicted Effect unknown
Transcript: ENSMUST00000171941
AA Change: A60P
SMART Domains Protein: ENSMUSP00000130545
Gene: ENSMUSG00000060671
AA Change: A60P

DomainStartEndE-ValueType
Pfam:HAD 2 158 3.3e-8 PFAM
Pfam:Hydrolase_3 124 167 1.7e-6 PFAM
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 94% (29/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,826,454 R103G probably benign Het
Bbox1 A G 2: 110,305,577 I19T possibly damaging Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fam135a A T 1: 24,014,811 M1215K probably damaging Het
Fam174b T C 7: 73,740,830 probably null Het
Fgfr1op2 A G 6: 146,595,233 I190V possibly damaging Het
Flt1 G A 5: 147,599,593 R813W probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Hacd3 T C 9: 65,021,473 E24G possibly damaging Het
Kat6b T G 14: 21,670,044 M1488R probably damaging Het
Kcnk3 T C 5: 30,621,930 V108A possibly damaging Het
Kif5a A G 10: 127,243,468 I287T probably damaging Het
Mical1 A C 10: 41,479,071 D192A probably benign Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Optn C A 2: 5,034,198 M371I possibly damaging Het
Pik3cg T C 12: 32,205,224 K255E probably damaging Het
Rims1 A T 1: 22,373,443 V380D probably damaging Het
Serpinb6e T A 13: 33,838,960 I147F probably benign Het
Slc13a1 T C 6: 24,134,477 M136V probably damaging Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tiam2 A G 17: 3,414,113 D39G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Ttn T A 2: 76,790,359 K13995* probably null Het
Vmn1r225 A G 17: 20,502,999 Q234R possibly damaging Het
Vmn2r107 A G 17: 20,374,889 N568S probably benign Het
Zfp605 G T 5: 110,128,698 G561W probably damaging Het
Zfp69 T A 4: 120,930,874 probably null Het
Other mutations in Atp8b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Atp8b2 APN 3 89949853 missense probably damaging 1.00
IGL02472:Atp8b2 APN 3 89954239 missense probably damaging 1.00
IGL02651:Atp8b2 APN 3 89954589 unclassified probably null
IGL03057:Atp8b2 APN 3 89944186 missense probably damaging 1.00
IGL03349:Atp8b2 APN 3 89957817 missense probably damaging 1.00
IGL03382:Atp8b2 APN 3 89948521 missense probably benign 0.00
R0550:Atp8b2 UTSW 3 89959061 splice site probably benign
R0784:Atp8b2 UTSW 3 89957073 missense probably damaging 0.99
R1249:Atp8b2 UTSW 3 89947804 missense possibly damaging 0.77
R1447:Atp8b2 UTSW 3 89944170 missense probably damaging 1.00
R1568:Atp8b2 UTSW 3 89949848 missense probably damaging 0.98
R1647:Atp8b2 UTSW 3 89941784 missense probably benign 0.30
R1736:Atp8b2 UTSW 3 89952694 missense probably damaging 0.98
R1907:Atp8b2 UTSW 3 89946276 missense probably benign 0.28
R2656:Atp8b2 UTSW 3 89941758 missense probably benign 0.05
R2888:Atp8b2 UTSW 3 89958293 missense probably damaging 1.00
R3706:Atp8b2 UTSW 3 89945152 missense probably damaging 0.99
R3708:Atp8b2 UTSW 3 89945152 missense probably damaging 0.99
R3741:Atp8b2 UTSW 3 89946031 missense probably benign
R3742:Atp8b2 UTSW 3 89946031 missense probably benign
R3896:Atp8b2 UTSW 3 89957319 missense probably damaging 1.00
R3914:Atp8b2 UTSW 3 89954448 missense probably damaging 0.98
R4536:Atp8b2 UTSW 3 89941784 missense probably benign 0.30
R4770:Atp8b2 UTSW 3 89957067 missense probably damaging 0.97
R4859:Atp8b2 UTSW 3 89945980 missense probably benign
R4905:Atp8b2 UTSW 3 89949008 missense probably benign
R4925:Atp8b2 UTSW 3 89946623 critical splice donor site probably null
R4955:Atp8b2 UTSW 3 89952920 unclassified probably benign
R5433:Atp8b2 UTSW 3 89952909 unclassified probably benign
R5458:Atp8b2 UTSW 3 89946022 missense probably benign 0.00
R5517:Atp8b2 UTSW 3 89946031 missense probably benign
R5663:Atp8b2 UTSW 3 89941794 missense probably benign 0.19
R6056:Atp8b2 UTSW 3 89946221 missense possibly damaging 0.79
R6821:Atp8b2 UTSW 3 89948173 missense probably damaging 0.99
R7069:Atp8b2 UTSW 3 89954571 missense probably damaging 1.00
R7178:Atp8b2 UTSW 3 89943672 missense possibly damaging 0.88
R7533:Atp8b2 UTSW 3 89945524 missense
R7552:Atp8b2 UTSW 3 89946764 missense probably damaging 1.00
Z1088:Atp8b2 UTSW 3 89954568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAAGCACTCAACAAGGTC -3'
(R):5'- TGACTGACGACATGACAGAG -3'

Sequencing Primer
(F):5'- AACAAGGTCTGAGCACTGTCCTG -3'
(R):5'- GTTTGTAGTCACAGGCCACACTG -3'
Posted On2015-03-18