Mutagenetix > Incidental Mutation

Incidental Mutation 'R3740:Vmn2r107'

270348

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r107

Ensembl Gene

ENSMUSG00000056910

Gene Name

vomeronasal 2, receptor 107

Synonyms

V2r6

MMRRC Submission

040726-MU

Accession Numbers

Genbank: NM_001104569; MGI: 1316664

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R3740 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20345425-20375772 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20374889 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 568 (N568S)

Ref Sequence

ENSEMBL: ENSMUSP00000048706 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042090]

AlphaFold

E9PZJ7

Predicted Effect

probably benign
Transcript: ENSMUST00000042090
AA Change: N568S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000048706
Gene: ENSMUSG00000056910
AA Change: N568S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	83	466	3.6e-40	PFAM
Pfam:NCD3G	509	562	5.1e-21	PFAM
Pfam:7tm_3	593	830	8e-51	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

94% (29/31)

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb3	T	C	1: 25,826,454	R103G	probably benign	Het
Atp8b2	C	G	3: 89,946,031	A726P	probably benign	Het
Bbox1	A	G	2: 110,305,577	I19T	possibly damaging	Het
Ctso	G	A	3: 81,952,249	V288I	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Fam135a	A	T	1: 24,014,811	M1215K	probably damaging	Het
Fam174b	T	C	7: 73,740,830		probably null	Het
Fgfr1op2	A	G	6: 146,595,233	I190V	possibly damaging	Het
Flt1	G	A	5: 147,599,593	R813W	probably damaging	Het
Gm6489	T	A	1: 31,287,683		noncoding transcript	Het
Hacd3	T	C	9: 65,021,473	E24G	possibly damaging	Het
Kat6b	T	G	14: 21,670,044	M1488R	probably damaging	Het
Kcnk3	T	C	5: 30,621,930	V108A	possibly damaging	Het
Kif5a	A	G	10: 127,243,468	I287T	probably damaging	Het
Mical1	A	C	10: 41,479,071	D192A	probably benign	Het
Mov10l1	A	G	15: 89,012,142	N678D	possibly damaging	Het
Nup210l	A	T	3: 90,207,394	M1759L	probably benign	Het
Optn	C	A	2: 5,034,198	M371I	possibly damaging	Het
Pik3cg	T	C	12: 32,205,224	K255E	probably damaging	Het
Rims1	A	T	1: 22,373,443	V380D	probably damaging	Het
Serpinb6e	T	A	13: 33,838,960	I147F	probably benign	Het
Slc13a1	T	C	6: 24,134,477	M136V	probably damaging	Het
Syngr4	T	C	7: 45,895,770	E5G	possibly damaging	Het
Tiam2	A	G	17: 3,414,113	D39G	possibly damaging	Het
Tmem88b	A	G	4: 155,785,427	L59P	probably damaging	Het
Ttn	T	A	2: 76,790,359	K13995*	probably null	Het
Vmn1r225	A	G	17: 20,502,999	Q234R	possibly damaging	Het
Zfp605	G	T	5: 110,128,698	G561W	probably damaging	Het
Zfp69	T	A	4: 120,930,874		probably null	Het

Other mutations in Vmn2r107

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Vmn2r107	APN	17	20375747	missense	probably damaging	0.98
IGL01768:Vmn2r107	APN	17	20345606	missense	probably benign	0.32
IGL02086:Vmn2r107	APN	17	20357800	missense	probably benign	0.00
IGL02136:Vmn2r107	APN	17	20374906	missense	probably benign	0.02
IGL02266:Vmn2r107	APN	17	20356777	missense	probably damaging	1.00
IGL02285:Vmn2r107	APN	17	20375561	missense	probably damaging	1.00
IGL02724:Vmn2r107	APN	17	20356744	missense	possibly damaging	0.49
IGL02998:Vmn2r107	APN	17	20357755	missense	probably damaging	0.99
IGL03089:Vmn2r107	APN	17	20375712	missense	probably benign	0.05
IGL03284:Vmn2r107	APN	17	20356911	missense	probably benign	0.07
IGL03307:Vmn2r107	APN	17	20356776	missense	probably benign	0.09
IGL03399:Vmn2r107	APN	17	20357958	splice site	probably benign
3-1:Vmn2r107	UTSW	17	20345504	missense	probably benign
BB006:Vmn2r107	UTSW	17	20345444	missense	probably null	0.96
BB016:Vmn2r107	UTSW	17	20345444	missense	probably null	0.96
R0285:Vmn2r107	UTSW	17	20345611	missense	probably benign	0.00
R0455:Vmn2r107	UTSW	17	20374823	splice site	probably benign
R0497:Vmn2r107	UTSW	17	20375132	missense	probably damaging	1.00
R0506:Vmn2r107	UTSW	17	20357759	missense	probably benign
R0621:Vmn2r107	UTSW	17	20374990	missense	probably benign	0.01
R0667:Vmn2r107	UTSW	17	20355654	missense	possibly damaging	0.91
R1118:Vmn2r107	UTSW	17	20356598	missense	probably benign	0.03
R1204:Vmn2r107	UTSW	17	20357769	missense	probably benign
R1237:Vmn2r107	UTSW	17	20356685	nonsense	probably null
R1485:Vmn2r107	UTSW	17	20374847	missense	possibly damaging	0.95
R1783:Vmn2r107	UTSW	17	20356513	missense	possibly damaging	0.51
R1873:Vmn2r107	UTSW	17	20345578	missense	probably benign	0.10
R1974:Vmn2r107	UTSW	17	20355617	splice site	probably null
R2009:Vmn2r107	UTSW	17	20375467	missense	probably benign	0.01
R2029:Vmn2r107	UTSW	17	20375287	missense	probably benign	0.01
R2164:Vmn2r107	UTSW	17	20375642	missense	probably damaging	1.00
R2269:Vmn2r107	UTSW	17	20375555	missense	possibly damaging	0.58
R3087:Vmn2r107	UTSW	17	20360345	missense	probably benign	0.03
R3961:Vmn2r107	UTSW	17	20375455	missense	probably damaging	1.00
R4031:Vmn2r107	UTSW	17	20375221	missense	probably benign	0.00
R4270:Vmn2r107	UTSW	17	20355779	missense	probably benign
R4963:Vmn2r107	UTSW	17	20375141	missense	probably damaging	1.00
R5121:Vmn2r107	UTSW	17	20355753	missense	probably benign	0.01
R5640:Vmn2r107	UTSW	17	20375164	missense	probably damaging	1.00
R6007:Vmn2r107	UTSW	17	20375054	missense	probably benign	0.19
R6238:Vmn2r107	UTSW	17	20345587	missense	probably benign	0.43
R6298:Vmn2r107	UTSW	17	20355782	missense	probably benign	0.00
R6467:Vmn2r107	UTSW	17	20375677	missense	probably damaging	0.99
R6726:Vmn2r107	UTSW	17	20375375	missense	probably damaging	0.96
R6782:Vmn2r107	UTSW	17	20356879	missense	probably damaging	1.00
R7299:Vmn2r107	UTSW	17	20345616	missense	probably benign	0.01
R7301:Vmn2r107	UTSW	17	20345616	missense	probably benign	0.01
R7375:Vmn2r107	UTSW	17	20355876	missense	probably benign
R7448:Vmn2r107	UTSW	17	20375732	missense	probably benign	0.00
R7495:Vmn2r107	UTSW	17	20375009	missense	possibly damaging	0.71
R7589:Vmn2r107	UTSW	17	20375372	missense	probably benign	0.05
R7594:Vmn2r107	UTSW	17	20360373	missense	probably benign	0.03
R7678:Vmn2r107	UTSW	17	20356639	missense	probably benign	0.01
R7929:Vmn2r107	UTSW	17	20345444	missense	probably null	0.96
R7974:Vmn2r107	UTSW	17	20357008	missense	probably benign	0.00
R8040:Vmn2r107	UTSW	17	20375546	missense	probably damaging	1.00
R8263:Vmn2r107	UTSW	17	20360352	missense	probably damaging	1.00
R8426:Vmn2r107	UTSW	17	20356977	missense	possibly damaging	0.91
R9175:Vmn2r107	UTSW	17	20356789	missense	possibly damaging	0.79
R9537:Vmn2r107	UTSW	17	20374887	missense	probably benign	0.00
R9642:Vmn2r107	UTSW	17	20360399	missense	probably damaging	1.00
R9711:Vmn2r107	UTSW	17	20357000	missense	probably damaging	1.00
X0022:Vmn2r107	UTSW	17	20356968	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- AGGAACAAAGTCCAGGCAAT -3'
(R):5'- GGGCTGACCAATGAAGTTCAAAG -3'

Sequencing Primer
(F):5'- AACAAAGTCCAGGCAATAGATATG -3'
(R):5'- GTGTGATGAGCAAAGTGTAACTC -3'

Posted On

2015-03-18