Mutagenetix > Incidental Mutation

Incidental Mutation 'R3741:Aspm'

270353

Institutional Source

Beutler Lab

Gene Symbol

Aspm

Ensembl Gene

ENSMUSG00000033952

Gene Name

abnormal spindle microtubule assembly

Synonyms

Sha1, D330028K02Rik, Calmbp1, MCPH5, Aspm

MMRRC Submission

040727-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3741 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

139382510-139421829 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 139406357 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1748 (V1748A)

Ref Sequence

ENSEMBL: ENSMUSP00000059159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053364] [ENSMUST00000200083]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053364
AA Change: V1748A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000059159
Gene: ENSMUSG00000033952
AA Change: V1748A

Domain	Start	End	E-Value	Type
Pfam:ASH	29	126	8.9e-35	PFAM
low complexity region	855	861	N/A	INTRINSIC
CH	890	1022	2.04e0	SMART
CH	1080	1224	5.56e-9	SMART
IQ	1233	1255	7.57e0	SMART
IQ	1259	1281	1.12e1	SMART
IQ	1282	1304	3.73e-1	SMART
IQ	1314	1336	2.41e-4	SMART
IQ	1360	1382	2.12e1	SMART
IQ	1387	1408	7.61e1	SMART
IQ	1409	1431	6.97e0	SMART
IQ	1432	1452	1.44e1	SMART
IQ	1453	1475	1.15e-1	SMART
IQ	1476	1495	1.66e2	SMART
IQ	1503	1525	1.65e-2	SMART
IQ	1526	1548	1.32e1	SMART
IQ	1549	1571	1.48e1	SMART
IQ	1572	1594	2.5e1	SMART
IQ	1599	1621	2.58e-4	SMART
IQ	1622	1644	6.7e-3	SMART
IQ	1645	1667	4.25e1	SMART
IQ	1668	1694	1.03e2	SMART
IQ	1695	1717	2.33e-2	SMART
IQ	1718	1740	7.79e0	SMART
IQ	1741	1763	1.57e2	SMART
IQ	1768	1790	2.68e-2	SMART
IQ	1791	1813	5.83e-3	SMART
IQ	1814	1836	5.93e1	SMART
IQ	1841	1863	1.92e-3	SMART
IQ	1864	1886	3.79e-2	SMART
IQ	1914	1936	4.11e0	SMART
IQ	1937	1959	1.87e-1	SMART
IQ	1960	1982	6.27e1	SMART
IQ	1987	2009	8.25e-3	SMART
IQ	2010	2032	5.73e0	SMART
IQ	2060	2082	1.39e0	SMART
IQ	2083	2105	4.62e1	SMART
IQ	2133	2155	5.58e0	SMART
IQ	2156	2178	7.07e-2	SMART
IQ	2206	2228	1.18e-3	SMART
IQ	2229	2251	4.59e0	SMART
IQ	2278	2300	1.85e-5	SMART
IQ	2301	2323	8.13e-2	SMART
IQ	2342	2364	9.62e-4	SMART
IQ	2365	2387	4.12e-3	SMART
IQ	2415	2437	7.58e-2	SMART
IQ	2438	2460	2.6e0	SMART
IQ	2490	2512	1.68e-3	SMART
IQ	2513	2535	8.51e1	SMART
IQ	2560	2582	2.14e-1	SMART
IQ	2601	2623	8.46e0	SMART
IQ	2647	2669	1.15e1	SMART
IQ	2673	2695	1.95e-4	SMART
IQ	2696	2718	4.13e1	SMART
IQ	2723	2745	1.02e-2	SMART
IQ	2761	2783	3.14e2	SMART
IQ	2784	2806	1e1	SMART
IQ	2825	2847	2.43e0	SMART
IQ	2848	2870	4.6e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196272

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199998

Predicted Effect

probably benign
Transcript: ENSMUST00000200083

SMART Domains

Protein: ENSMUSP00000142880
Gene: ENSMUSG00000033952

Domain	Start	End	E-Value	Type
low complexity region	855	861	N/A	INTRINSIC
CH	890	1022	2.04e0	SMART
CH	1080	1224	5.56e-9	SMART
IQ	1233	1255	7.57e0	SMART
IQ	1259	1281	1.12e1	SMART
IQ	1282	1304	3.73e-1	SMART
IQ	1314	1336	1.25e1	SMART
IQ	1337	1358	2.96e1	SMART
IQ	1382	1404	1.15e1	SMART
IQ	1408	1430	1.95e-4	SMART
IQ	1431	1453	4.13e1	SMART
IQ	1458	1480	1.02e-2	SMART
IQ	1496	1518	3.14e2	SMART
IQ	1519	1541	1e1	SMART
IQ	1560	1582	2.43e0	SMART
IQ	1583	1605	4.6e-1	SMART

Meta Mutation Damage Score

0.1219

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for protein-truncating gene trap mutations of this gene exhibit decreased body weight, microcephaly, a severe reduction in brain, testis and ovary weight, oligozoospermia and asthenospermia, and reduced fertility in both sexes. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp10b	A	T	11: 43,126,489 (GRCm39)	S1082C	probably damaging	Het
Atp8b2	C	G	3: 89,853,338 (GRCm39)	A726P	probably benign	Het
B4galt3	C	A	1: 171,101,613 (GRCm39)	H196N	probably damaging	Het
Bbip1	T	C	19: 53,920,606 (GRCm39)	M1V	probably null	Het
Bbox1	A	G	2: 110,135,922 (GRCm39)	I19T	possibly damaging	Het
Bclaf3	T	A	X: 158,334,828 (GRCm39)	H41Q	probably benign	Het
Ctsm	T	A	13: 61,687,441 (GRCm39)	Q107L	probably benign	Het
Ctso	G	A	3: 81,859,556 (GRCm39)	V288I	probably benign	Het
Cyp2a4	A	C	7: 26,007,969 (GRCm39)	K125N	probably damaging	Het
Dapk1	T	C	13: 60,896,014 (GRCm39)	S701P	probably benign	Het
Dnah1	A	G	14: 30,987,424 (GRCm39)		probably benign	Het
Dnah11	A	G	12: 118,095,076 (GRCm39)	M718T	probably benign	Het
Dnah2	C	A	11: 69,339,295 (GRCm39)	A3071S	probably damaging	Het
Epb41l4a	A	T	18: 33,961,155 (GRCm39)		probably null	Het
Fam135a	A	T	1: 24,053,892 (GRCm39)	M1215K	probably damaging	Het
Gm6489	T	A	1: 31,326,764 (GRCm39)		noncoding transcript	Het
Hhipl1	A	G	12: 108,284,976 (GRCm39)	Y443C	probably damaging	Het
Hoxc13	G	A	15: 102,829,873 (GRCm39)	G84D	possibly damaging	Het
Ifi207	T	C	1: 173,555,128 (GRCm39)	I851M	probably damaging	Het
Lipk	T	G	19: 33,999,107 (GRCm39)	L134R	probably damaging	Het
Mov10l1	A	G	15: 88,896,345 (GRCm39)	N678D	possibly damaging	Het
Msrb3	A	T	10: 120,620,119 (GRCm39)	F67I	probably damaging	Het
Myo1a	A	G	10: 127,550,767 (GRCm39)	D593G	probably benign	Het
Nsf	C	T	11: 103,821,578 (GRCm39)	E26K	possibly damaging	Het
Nup210l	A	T	3: 90,114,701 (GRCm39)	M1759L	probably benign	Het
Optn	C	A	2: 5,039,009 (GRCm39)	M371I	possibly damaging	Het
Rims1	A	T	1: 22,443,667 (GRCm39)	V380D	probably damaging	Het
Rnf148	A	G	6: 23,654,064 (GRCm39)	C311R	possibly damaging	Het
Rrp12	T	C	19: 41,874,167 (GRCm39)	D377G	probably damaging	Het
Sbp	T	A	17: 24,164,556 (GRCm39)		probably benign	Het
Sipa1	T	C	19: 5,704,885 (GRCm39)	E570G	probably damaging	Het
Spem2	T	C	11: 69,707,556 (GRCm39)	R470G	possibly damaging	Het
Syngr4	T	C	7: 45,545,194 (GRCm39)	E5G	possibly damaging	Het
Tmem88b	A	G	4: 155,869,884 (GRCm39)	L59P	probably damaging	Het
Ttn	T	A	2: 76,620,703 (GRCm39)	K13995*	probably null	Het
Vmn1r69	A	G	7: 10,314,069 (GRCm39)	Y221H	possibly damaging	Het
Zfp386	T	A	12: 116,023,170 (GRCm39)	L296*	probably null	Het

Other mutations in Aspm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Aspm	APN	1	139,406,429 (GRCm39)	missense	probably damaging	1.00
IGL00594:Aspm	APN	1	139,415,160 (GRCm39)	splice site	probably benign
IGL00808:Aspm	APN	1	139,389,214 (GRCm39)	missense	probably benign	0.03
IGL00897:Aspm	APN	1	139,405,145 (GRCm39)	missense	probably damaging	0.98
IGL01024:Aspm	APN	1	139,405,862 (GRCm39)	missense	possibly damaging	0.66
IGL01410:Aspm	APN	1	139,410,182 (GRCm39)	missense	probably benign	0.25
IGL01588:Aspm	APN	1	139,405,900 (GRCm39)	missense	probably benign	0.11
IGL01610:Aspm	APN	1	139,417,408 (GRCm39)	nonsense	probably null
IGL01633:Aspm	APN	1	139,408,574 (GRCm39)	missense	possibly damaging	0.93
IGL01982:Aspm	APN	1	139,419,326 (GRCm39)	missense	probably benign	0.12
IGL02429:Aspm	APN	1	139,407,548 (GRCm39)	missense	probably benign	0.27
IGL02468:Aspm	APN	1	139,408,688 (GRCm39)	missense	probably damaging	1.00
IGL02519:Aspm	APN	1	139,389,665 (GRCm39)	splice site	probably benign
IGL02526:Aspm	APN	1	139,417,457 (GRCm39)	missense	probably benign	0.03
IGL02716:Aspm	APN	1	139,407,425 (GRCm39)	missense	probably damaging	1.00
IGL02876:Aspm	APN	1	139,401,391 (GRCm39)	missense	probably damaging	1.00
IGL02953:Aspm	APN	1	139,385,157 (GRCm39)	missense	probably benign	0.01
IGL03275:Aspm	APN	1	139,415,033 (GRCm39)	missense	probably damaging	1.00
Stemware	UTSW	1	139,405,197 (GRCm39)	nonsense	probably null
3-1:Aspm	UTSW	1	139,385,279 (GRCm39)	missense	probably benign
R0016:Aspm	UTSW	1	139,407,282 (GRCm39)	missense	probably benign	0.01
R0016:Aspm	UTSW	1	139,407,282 (GRCm39)	missense	probably benign	0.01
R0106:Aspm	UTSW	1	139,404,614 (GRCm39)	missense	probably benign	0.02
R0106:Aspm	UTSW	1	139,404,614 (GRCm39)	missense	probably benign	0.02
R0140:Aspm	UTSW	1	139,408,379 (GRCm39)	missense	probably benign	0.00
R0195:Aspm	UTSW	1	139,406,873 (GRCm39)	missense	probably damaging	1.00
R0217:Aspm	UTSW	1	139,385,618 (GRCm39)	missense	possibly damaging	0.46
R0276:Aspm	UTSW	1	139,406,209 (GRCm39)	missense	possibly damaging	0.95
R0309:Aspm	UTSW	1	139,410,249 (GRCm39)	splice site	probably benign
R0466:Aspm	UTSW	1	139,405,639 (GRCm39)	missense	probably damaging	1.00
R0520:Aspm	UTSW	1	139,406,558 (GRCm39)	missense	possibly damaging	0.51
R0615:Aspm	UTSW	1	139,415,027 (GRCm39)	missense	probably damaging	1.00
R0626:Aspm	UTSW	1	139,419,339 (GRCm39)	missense	probably damaging	1.00
R0660:Aspm	UTSW	1	139,385,502 (GRCm39)	missense	probably benign	0.03
R0751:Aspm	UTSW	1	139,384,636 (GRCm39)	splice site	probably benign
R0830:Aspm	UTSW	1	139,401,992 (GRCm39)	missense	probably damaging	0.99
R1109:Aspm	UTSW	1	139,384,496 (GRCm39)	missense	probably damaging	0.99
R1114:Aspm	UTSW	1	139,389,662 (GRCm39)	splice site	probably benign
R1130:Aspm	UTSW	1	139,405,572 (GRCm39)	missense	possibly damaging	0.90
R1298:Aspm	UTSW	1	139,385,157 (GRCm39)	missense	probably benign	0.01
R1386:Aspm	UTSW	1	139,385,361 (GRCm39)	missense	probably benign	0.03
R1386:Aspm	UTSW	1	139,406,710 (GRCm39)	missense	possibly damaging	0.80
R1557:Aspm	UTSW	1	139,396,406 (GRCm39)	missense	probably benign	0.01
R1625:Aspm	UTSW	1	139,408,777 (GRCm39)	missense	probably benign	0.01
R1728:Aspm	UTSW	1	139,401,312 (GRCm39)	missense	probably benign
R1729:Aspm	UTSW	1	139,401,312 (GRCm39)	missense	probably benign
R1730:Aspm	UTSW	1	139,401,312 (GRCm39)	missense	probably benign
R1733:Aspm	UTSW	1	139,384,855 (GRCm39)	missense	probably benign	0.27
R1739:Aspm	UTSW	1	139,401,312 (GRCm39)	missense	probably benign
R1762:Aspm	UTSW	1	139,401,312 (GRCm39)	missense	probably benign
R1783:Aspm	UTSW	1	139,401,312 (GRCm39)	missense	probably benign
R1784:Aspm	UTSW	1	139,401,312 (GRCm39)	missense	probably benign
R1785:Aspm	UTSW	1	139,401,312 (GRCm39)	missense	probably benign
R1793:Aspm	UTSW	1	139,385,079 (GRCm39)	missense	probably benign	0.00
R1893:Aspm	UTSW	1	139,407,605 (GRCm39)	missense	probably damaging	1.00
R1911:Aspm	UTSW	1	139,405,832 (GRCm39)	missense	probably benign	0.06
R2103:Aspm	UTSW	1	139,419,403 (GRCm39)	missense	probably damaging	0.99
R2128:Aspm	UTSW	1	139,385,373 (GRCm39)	missense	probably benign	0.14
R2129:Aspm	UTSW	1	139,385,373 (GRCm39)	missense	probably benign	0.14
R2239:Aspm	UTSW	1	139,384,584 (GRCm39)	missense	possibly damaging	0.67
R2352:Aspm	UTSW	1	139,385,300 (GRCm39)	missense	probably benign	0.02
R2353:Aspm	UTSW	1	139,405,435 (GRCm39)	missense	probably damaging	1.00
R2380:Aspm	UTSW	1	139,407,086 (GRCm39)	missense	probably damaging	1.00
R2413:Aspm	UTSW	1	139,405,495 (GRCm39)	missense	probably damaging	1.00
R2421:Aspm	UTSW	1	139,416,225 (GRCm39)	missense	possibly damaging	0.49
R3607:Aspm	UTSW	1	139,408,406 (GRCm39)	missense	probably benign	0.13
R3711:Aspm	UTSW	1	139,385,838 (GRCm39)	missense	probably benign	0.17
R3718:Aspm	UTSW	1	139,418,165 (GRCm39)	missense	probably benign	0.31
R3718:Aspm	UTSW	1	139,408,627 (GRCm39)	missense	probably benign	0.09
R3788:Aspm	UTSW	1	139,390,941 (GRCm39)	missense	probably damaging	1.00
R3838:Aspm	UTSW	1	139,405,792 (GRCm39)	missense	probably benign	0.24
R3839:Aspm	UTSW	1	139,405,792 (GRCm39)	missense	probably benign	0.24
R3849:Aspm	UTSW	1	139,386,024 (GRCm39)	missense	probably benign	0.21
R4075:Aspm	UTSW	1	139,402,023 (GRCm39)	missense	probably damaging	1.00
R4080:Aspm	UTSW	1	139,398,493 (GRCm39)	missense	probably damaging	1.00
R4463:Aspm	UTSW	1	139,382,748 (GRCm39)	missense	possibly damaging	0.95
R4537:Aspm	UTSW	1	139,402,041 (GRCm39)	missense	probably benign	0.01
R4547:Aspm	UTSW	1	139,405,925 (GRCm39)	missense	possibly damaging	0.75
R4573:Aspm	UTSW	1	139,407,245 (GRCm39)	missense	probably damaging	0.98
R4680:Aspm	UTSW	1	139,408,409 (GRCm39)	missense	probably benign	0.05
R4807:Aspm	UTSW	1	139,405,657 (GRCm39)	missense	probably damaging	1.00
R4840:Aspm	UTSW	1	139,398,269 (GRCm39)	missense	possibly damaging	0.83
R4854:Aspm	UTSW	1	139,405,810 (GRCm39)	nonsense	probably null
R4859:Aspm	UTSW	1	139,397,131 (GRCm39)	missense	probably damaging	1.00
R4893:Aspm	UTSW	1	139,417,577 (GRCm39)	critical splice donor site	probably null
R4910:Aspm	UTSW	1	139,419,281 (GRCm39)	missense	probably damaging	1.00
R4953:Aspm	UTSW	1	139,399,472 (GRCm39)	missense	probably benign	0.00
R4974:Aspm	UTSW	1	139,405,748 (GRCm39)	missense	probably benign	0.03
R4981:Aspm	UTSW	1	139,398,498 (GRCm39)	splice site	probably null
R5082:Aspm	UTSW	1	139,406,414 (GRCm39)	nonsense	probably null
R5223:Aspm	UTSW	1	139,406,072 (GRCm39)	missense	probably damaging	1.00
R5268:Aspm	UTSW	1	139,392,033 (GRCm39)	missense	probably damaging	1.00
R5371:Aspm	UTSW	1	139,398,279 (GRCm39)	nonsense	probably null
R5377:Aspm	UTSW	1	139,398,133 (GRCm39)	splice site	probably null
R5377:Aspm	UTSW	1	139,385,221 (GRCm39)	missense	probably damaging	0.96
R5481:Aspm	UTSW	1	139,384,799 (GRCm39)	missense	possibly damaging	0.85
R5513:Aspm	UTSW	1	139,410,136 (GRCm39)	missense	probably damaging	1.00
R5578:Aspm	UTSW	1	139,398,455 (GRCm39)	missense	probably damaging	1.00
R5649:Aspm	UTSW	1	139,407,407 (GRCm39)	missense	probably benign
R5685:Aspm	UTSW	1	139,415,026 (GRCm39)	missense	probably benign	0.10
R5695:Aspm	UTSW	1	139,407,407 (GRCm39)	missense	probably benign
R5766:Aspm	UTSW	1	139,406,740 (GRCm39)	missense	probably damaging	0.99
R5964:Aspm	UTSW	1	139,382,965 (GRCm39)	intron	probably benign
R5993:Aspm	UTSW	1	139,407,269 (GRCm39)	missense	probably benign	0.28
R6027:Aspm	UTSW	1	139,390,794 (GRCm39)	missense	probably damaging	1.00
R6029:Aspm	UTSW	1	139,408,728 (GRCm39)	missense	possibly damaging	0.83
R6102:Aspm	UTSW	1	139,405,197 (GRCm39)	nonsense	probably null
R6188:Aspm	UTSW	1	139,406,977 (GRCm39)	missense	possibly damaging	0.79
R6257:Aspm	UTSW	1	139,409,791 (GRCm39)	splice site	probably null
R6433:Aspm	UTSW	1	139,401,421 (GRCm39)	missense	probably damaging	1.00
R6682:Aspm	UTSW	1	139,385,460 (GRCm39)	missense	possibly damaging	0.67
R6763:Aspm	UTSW	1	139,398,255 (GRCm39)	missense	possibly damaging	0.64
R6798:Aspm	UTSW	1	139,396,423 (GRCm39)	missense	possibly damaging	0.66
R6815:Aspm	UTSW	1	139,407,880 (GRCm39)	missense	probably benign	0.04
R6854:Aspm	UTSW	1	139,390,920 (GRCm39)	missense	possibly damaging	0.90
R6928:Aspm	UTSW	1	139,407,944 (GRCm39)	nonsense	probably null
R6943:Aspm	UTSW	1	139,408,280 (GRCm39)	missense	probably damaging	1.00
R6979:Aspm	UTSW	1	139,408,223 (GRCm39)	missense	probably damaging	1.00
R6998:Aspm	UTSW	1	139,397,210 (GRCm39)	missense	probably damaging	1.00
R7126:Aspm	UTSW	1	139,408,541 (GRCm39)	missense	probably benign	0.27
R7237:Aspm	UTSW	1	139,405,667 (GRCm39)	missense	possibly damaging	0.81
R7240:Aspm	UTSW	1	139,406,389 (GRCm39)	nonsense	probably null
R7272:Aspm	UTSW	1	139,386,066 (GRCm39)	missense	probably benign	0.14
R7427:Aspm	UTSW	1	139,385,354 (GRCm39)	missense	probably benign	0.01
R7519:Aspm	UTSW	1	139,418,074 (GRCm39)	missense	possibly damaging	0.53
R7776:Aspm	UTSW	1	139,407,584 (GRCm39)	missense	possibly damaging	0.85
R7875:Aspm	UTSW	1	139,382,872 (GRCm39)	missense	probably benign	0.02
R7883:Aspm	UTSW	1	139,406,405 (GRCm39)	missense	possibly damaging	0.47
R7964:Aspm	UTSW	1	139,408,424 (GRCm39)	missense	probably damaging	1.00
R8012:Aspm	UTSW	1	139,385,202 (GRCm39)	missense	probably benign	0.03
R8029:Aspm	UTSW	1	139,399,370 (GRCm39)	missense	probably benign	0.00
R8233:Aspm	UTSW	1	139,385,042 (GRCm39)	missense	probably benign	0.28
R8277:Aspm	UTSW	1	139,382,748 (GRCm39)	missense	probably damaging	1.00
R8345:Aspm	UTSW	1	139,392,011 (GRCm39)	nonsense	probably null
R8491:Aspm	UTSW	1	139,385,433 (GRCm39)	missense	probably damaging	0.98
R8511:Aspm	UTSW	1	139,385,046 (GRCm39)	missense	probably damaging	1.00
R8557:Aspm	UTSW	1	139,384,494 (GRCm39)	missense	probably benign	0.01
R8927:Aspm	UTSW	1	139,418,125 (GRCm39)	nonsense	probably null
R8928:Aspm	UTSW	1	139,418,125 (GRCm39)	nonsense	probably null
R8950:Aspm	UTSW	1	139,406,690 (GRCm39)	missense	probably damaging	1.00
R9033:Aspm	UTSW	1	139,405,865 (GRCm39)	missense	probably damaging	1.00
R9083:Aspm	UTSW	1	139,421,436 (GRCm39)	missense	possibly damaging	0.70
R9133:Aspm	UTSW	1	139,419,266 (GRCm39)	missense	probably damaging	1.00
R9160:Aspm	UTSW	1	139,417,862 (GRCm39)	missense	probably damaging	1.00
R9179:Aspm	UTSW	1	139,404,453 (GRCm39)	missense	probably damaging	1.00
R9265:Aspm	UTSW	1	139,389,182 (GRCm39)	missense	probably benign	0.24
R9400:Aspm	UTSW	1	139,407,641 (GRCm39)	missense	probably damaging	1.00
R9419:Aspm	UTSW	1	139,384,923 (GRCm39)	missense	probably benign	0.29
R9454:Aspm	UTSW	1	139,408,732 (GRCm39)	missense	probably benign	0.00
R9517:Aspm	UTSW	1	139,407,167 (GRCm39)	missense	probably damaging	1.00
R9524:Aspm	UTSW	1	139,408,607 (GRCm39)	missense	probably damaging	1.00
R9544:Aspm	UTSW	1	139,385,523 (GRCm39)	missense	probably benign	0.01
R9640:Aspm	UTSW	1	139,408,010 (GRCm39)	missense	possibly damaging	0.88
R9698:Aspm	UTSW	1	139,389,646 (GRCm39)	missense	probably benign	0.28
R9790:Aspm	UTSW	1	139,408,375 (GRCm39)	missense	probably damaging	0.98
R9791:Aspm	UTSW	1	139,408,375 (GRCm39)	missense	probably damaging	0.98
R9794:Aspm	UTSW	1	139,406,480 (GRCm39)	missense	probably damaging	0.99
X0063:Aspm	UTSW	1	139,385,828 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GAGTACATACAGGTGCGTGAATC -3'
(R):5'- AAGCAACCTTCTGTGCCCTG -3'

Sequencing Primer
(F):5'- CAGGTGCGTGAATCCTGTATCAAAC -3'
(R):5'- TCTGACTGTGGCCTCTAAAAAC -3'

Posted On

2015-03-18