Incidental Mutation 'R3741:B4galt3'
ID270354
Institutional Source Beutler Lab
Gene Symbol B4galt3
Ensembl Gene ENSMUSG00000052423
Gene NameUDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3
Synonyms9530061M23Rik, R74981, ESTM26, beta4GalT-III
MMRRC Submission 040727-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock #R3741 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171270328-171276896 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 171274043 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 196 (H196N)
Ref Sequence ENSEMBL: ENSMUSP00000106945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064272] [ENSMUST00000073120] [ENSMUST00000111313] [ENSMUST00000126699] [ENSMUST00000141114] [ENSMUST00000141999] [ENSMUST00000151863] [ENSMUST00000192956]
Predicted Effect probably damaging
Transcript: ENSMUST00000064272
AA Change: H196N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066353
Gene: ENSMUSG00000052423
AA Change: H196N

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 212 1.7e-59 PFAM
Pfam:Glyco_transf_7C 217 294 6.3e-32 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073120
SMART Domains Protein: ENSMUSP00000072863
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 74 1.3e-9 PFAM
Pfam:Amino_oxidase 12 471 1.7e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111313
AA Change: H196N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106945
Gene: ENSMUSG00000052423
AA Change: H196N

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 214 2.1e-74 PFAM
Pfam:Glyco_transf_7C 217 294 1.7e-31 PFAM
Pfam:Glyco_tranf_2_2 238 298 1e-6 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125939
Predicted Effect probably benign
Transcript: ENSMUST00000126699
SMART Domains Protein: ENSMUSP00000141958
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
Pfam:Glyco_transf_7C 1 72 3.2e-28 PFAM
Pfam:Glyco_tranf_2_2 16 76 2.1e-5 PFAM
low complexity region 126 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138904
Predicted Effect probably benign
Transcript: ENSMUST00000141114
SMART Domains Protein: ENSMUSP00000114560
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
Pfam:Glyco_transf_7N 104 139 2.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141999
SMART Domains Protein: ENSMUSP00000114926
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155083
Predicted Effect probably benign
Transcript: ENSMUST00000192956
SMART Domains Protein: ENSMUSP00000141835
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 72 1.6e-7 PFAM
Pfam:Amino_oxidase 12 389 4.7e-29 PFAM
Meta Mutation Damage Score 0.5682 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene encodes an enzyme that may be mainly involved in the synthesis of the first N-acetyllactosamine unit of poly-N-acetyllactosamine chains. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,478,619 V1748A possibly damaging Het
Atp10b A T 11: 43,235,662 S1082C probably damaging Het
Atp8b2 C G 3: 89,946,031 A726P probably benign Het
Bbip1 T C 19: 53,932,175 M1V probably null Het
Bbox1 A G 2: 110,305,577 I19T possibly damaging Het
Bclaf3 T A X: 159,551,832 H41Q probably benign Het
Ctsm T A 13: 61,539,627 Q107L probably benign Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Cyp2a4 A C 7: 26,308,544 K125N probably damaging Het
Dapk1 T C 13: 60,748,200 S701P probably benign Het
Dnah1 A G 14: 31,265,467 probably benign Het
Dnah11 A G 12: 118,131,341 M718T probably benign Het
Dnah2 C A 11: 69,448,469 A3071S probably damaging Het
Epb41l4a A T 18: 33,828,102 probably null Het
Fam135a A T 1: 24,014,811 M1215K probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Hhipl1 A G 12: 108,318,717 Y443C probably damaging Het
Hoxc13 G A 15: 102,921,438 G84D possibly damaging Het
Ifi207 T C 1: 173,727,562 I851M probably damaging Het
Lipk T G 19: 34,021,707 L134R probably damaging Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Msrb3 A T 10: 120,784,214 F67I probably damaging Het
Myo1a A G 10: 127,714,898 D593G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Optn C A 2: 5,034,198 M371I possibly damaging Het
Rims1 A T 1: 22,373,443 V380D probably damaging Het
Rnf148 A G 6: 23,654,065 C311R possibly damaging Het
Rrp12 T C 19: 41,885,728 D377G probably damaging Het
Sbp T A 17: 23,945,582 probably benign Het
Sipa1 T C 19: 5,654,857 E570G probably damaging Het
Spem2 T C 11: 69,816,730 R470G possibly damaging Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Ttn T A 2: 76,790,359 K13995* probably null Het
Vmn1r69 A G 7: 10,580,142 Y221H possibly damaging Het
Zfp386 T A 12: 116,059,550 L296* probably null Het
Other mutations in B4galt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:B4galt3 APN 1 171271792 missense probably damaging 1.00
BB004:B4galt3 UTSW 1 171271772 nonsense probably null
BB014:B4galt3 UTSW 1 171271772 nonsense probably null
R0026:B4galt3 UTSW 1 171274261 unclassified probably benign
R0126:B4galt3 UTSW 1 171276165 missense probably damaging 0.97
R0537:B4galt3 UTSW 1 171274251 unclassified probably benign
R1478:B4galt3 UTSW 1 171276365 missense probably benign 0.11
R2012:B4galt3 UTSW 1 171272548 missense probably damaging 1.00
R2206:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2207:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2223:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2353:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2354:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2438:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2439:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3039:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3051:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3709:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3710:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3742:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3813:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3953:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4058:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4059:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4323:B4galt3 UTSW 1 171275942 missense possibly damaging 0.93
R4367:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4368:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4370:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4371:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4486:B4galt3 UTSW 1 171271773 missense possibly damaging 0.94
R4538:B4galt3 UTSW 1 171272710 missense probably damaging 1.00
R5557:B4galt3 UTSW 1 171272519 critical splice acceptor site probably null
R7313:B4galt3 UTSW 1 171272749 missense probably damaging 1.00
R7927:B4galt3 UTSW 1 171271772 nonsense probably null
R8222:B4galt3 UTSW 1 171272683 missense possibly damaging 0.46
R8552:B4galt3 UTSW 1 171274347 missense possibly damaging 0.70
R8804:B4galt3 UTSW 1 171276374 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CTGCTTGGGTGCTCTCTTCA -3'
(R):5'- TCCGCCAAAGTACTGGGG -3'

Sequencing Primer
(F):5'- GGGTGCTCTCTTCACTTTGGC -3'
(R):5'- AGATCCCTGCGGTTCACAAATTTG -3'
Posted On2015-03-18