Incidental Mutation 'R3741:Vmn1r69'
ID270365
Institutional Source Beutler Lab
Gene Symbol Vmn1r69
Ensembl Gene ENSMUSG00000091662
Gene Namevomeronasal 1 receptor 69
SynonymsV1re9
MMRRC Submission 040727-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R3741 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location10578930-10613659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10580142 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 221 (Y221H)
Ref Sequence ENSEMBL: ENSMUSP00000154076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163658] [ENSMUST00000176284] [ENSMUST00000176707] [ENSMUST00000226160] [ENSMUST00000226190] [ENSMUST00000226228] [ENSMUST00000227853] [ENSMUST00000228296] [ENSMUST00000228478] [ENSMUST00000228638]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163658
AA Change: Y221H

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129646
Gene: ENSMUSG00000091662
AA Change: Y221H

DomainStartEndE-ValueType
Pfam:V1R 50 307 3.3e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176284
AA Change: Y221H

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000176707
AA Change: Y221H

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226160
AA Change: Y221H

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226190
AA Change: Y221H

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226228
AA Change: Y221H

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226990
Predicted Effect probably benign
Transcript: ENSMUST00000227853
AA Change: Y142H

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000228296
AA Change: Y142H

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000228478
AA Change: Y142H

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000228638
AA Change: Y142H

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,478,619 V1748A possibly damaging Het
Atp10b A T 11: 43,235,662 S1082C probably damaging Het
Atp8b2 C G 3: 89,946,031 A726P probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bbip1 T C 19: 53,932,175 M1V probably null Het
Bbox1 A G 2: 110,305,577 I19T possibly damaging Het
Bclaf3 T A X: 159,551,832 H41Q probably benign Het
Ctsm T A 13: 61,539,627 Q107L probably benign Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Cyp2a4 A C 7: 26,308,544 K125N probably damaging Het
Dapk1 T C 13: 60,748,200 S701P probably benign Het
Dnah1 A G 14: 31,265,467 probably benign Het
Dnah11 A G 12: 118,131,341 M718T probably benign Het
Dnah2 C A 11: 69,448,469 A3071S probably damaging Het
Epb41l4a A T 18: 33,828,102 probably null Het
Fam135a A T 1: 24,014,811 M1215K probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Hhipl1 A G 12: 108,318,717 Y443C probably damaging Het
Hoxc13 G A 15: 102,921,438 G84D possibly damaging Het
Ifi207 T C 1: 173,727,562 I851M probably damaging Het
Lipk T G 19: 34,021,707 L134R probably damaging Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Msrb3 A T 10: 120,784,214 F67I probably damaging Het
Myo1a A G 10: 127,714,898 D593G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Optn C A 2: 5,034,198 M371I possibly damaging Het
Rims1 A T 1: 22,373,443 V380D probably damaging Het
Rnf148 A G 6: 23,654,065 C311R possibly damaging Het
Rrp12 T C 19: 41,885,728 D377G probably damaging Het
Sbp T A 17: 23,945,582 probably benign Het
Sipa1 T C 19: 5,654,857 E570G probably damaging Het
Spem2 T C 11: 69,816,730 R470G possibly damaging Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Ttn T A 2: 76,790,359 K13995* probably null Het
Zfp386 T A 12: 116,059,550 L296* probably null Het
Other mutations in Vmn1r69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Vmn1r69 APN 7 10579952 missense probably benign 0.00
IGL01972:Vmn1r69 APN 7 10580659 nonsense probably null
IGL02339:Vmn1r69 APN 7 10580718 nonsense probably null
IGL02424:Vmn1r69 APN 7 10580658 missense probably benign 0.00
IGL02602:Vmn1r69 APN 7 10579974 missense probably benign 0.14
IGL03271:Vmn1r69 APN 7 10580669 missense probably benign 0.11
R0034:Vmn1r69 UTSW 7 10580811 intron probably benign
R0052:Vmn1r69 UTSW 7 10580400 missense probably benign 0.00
R0096:Vmn1r69 UTSW 7 10580058 missense probably damaging 1.00
R0539:Vmn1r69 UTSW 7 10580947 splice site probably benign
R0604:Vmn1r69 UTSW 7 10580654 missense probably benign 0.00
R1681:Vmn1r69 UTSW 7 10580252 missense probably benign 0.06
R1884:Vmn1r69 UTSW 7 10580751 missense probably benign 0.00
R4655:Vmn1r69 UTSW 7 10580099 missense probably benign 0.03
R4735:Vmn1r69 UTSW 7 10580999 utr 5 prime probably benign
R4758:Vmn1r69 UTSW 7 10580546 missense probably benign 0.00
R5582:Vmn1r69 UTSW 7 10580508 missense probably damaging 1.00
R5966:Vmn1r69 UTSW 7 10580790 missense probably benign 0.00
R5977:Vmn1r69 UTSW 7 10580490 missense probably damaging 1.00
R6458:Vmn1r69 UTSW 7 10580438 missense probably benign
R6987:Vmn1r69 UTSW 7 10580564 start codon destroyed probably null 0.99
R7133:Vmn1r69 UTSW 7 10581068 intron probably benign
R7532:Vmn1r69 UTSW 7 10580354 missense probably damaging 0.98
R7878:Vmn1r69 UTSW 7 10580790 missense probably benign 0.00
R7961:Vmn1r69 UTSW 7 10580790 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGATGTTTAGGAGCCACCAATTG -3'
(R):5'- AGTACGTTGGCTACTCCTTGTC -3'

Sequencing Primer
(F):5'- CCACCAATTGGGATTATTCTGAAGAG -3'
(R):5'- GGGTCCTGCACATTTTTATAAATTTC -3'
Posted On2015-03-18