Incidental Mutation 'R3741:Cyp2a4'
ID270366
Institutional Source Beutler Lab
Gene Symbol Cyp2a4
Ensembl Gene ENSMUSG00000074254
Gene Namecytochrome P450, family 2, subfamily a, polypeptide 4
SynonymsD7Ucla4, Cyp15a1, testosterone 15alpha-hydroxylase
MMRRC Submission 040727-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R3741 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26307169-26315088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 26308544 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 125 (K125N)
Ref Sequence ENSEMBL: ENSMUSP00000096254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098657]
Predicted Effect probably damaging
Transcript: ENSMUST00000098657
AA Change: K125N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096254
Gene: ENSMUSG00000074254
AA Change: K125N

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 34 491 8.9e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206226
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,478,619 V1748A possibly damaging Het
Atp10b A T 11: 43,235,662 S1082C probably damaging Het
Atp8b2 C G 3: 89,946,031 A726P probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bbip1 T C 19: 53,932,175 M1V probably null Het
Bbox1 A G 2: 110,305,577 I19T possibly damaging Het
Bclaf3 T A X: 159,551,832 H41Q probably benign Het
Ctsm T A 13: 61,539,627 Q107L probably benign Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Dapk1 T C 13: 60,748,200 S701P probably benign Het
Dnah1 A G 14: 31,265,467 probably benign Het
Dnah11 A G 12: 118,131,341 M718T probably benign Het
Dnah2 C A 11: 69,448,469 A3071S probably damaging Het
Epb41l4a A T 18: 33,828,102 probably null Het
Fam135a A T 1: 24,014,811 M1215K probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Hhipl1 A G 12: 108,318,717 Y443C probably damaging Het
Hoxc13 G A 15: 102,921,438 G84D possibly damaging Het
Ifi207 T C 1: 173,727,562 I851M probably damaging Het
Lipk T G 19: 34,021,707 L134R probably damaging Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Msrb3 A T 10: 120,784,214 F67I probably damaging Het
Myo1a A G 10: 127,714,898 D593G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Optn C A 2: 5,034,198 M371I possibly damaging Het
Rims1 A T 1: 22,373,443 V380D probably damaging Het
Rnf148 A G 6: 23,654,065 C311R possibly damaging Het
Rrp12 T C 19: 41,885,728 D377G probably damaging Het
Sbp T A 17: 23,945,582 probably benign Het
Sipa1 T C 19: 5,654,857 E570G probably damaging Het
Spem2 T C 11: 69,816,730 R470G possibly damaging Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Ttn T A 2: 76,790,359 K13995* probably null Het
Vmn1r69 A G 7: 10,580,142 Y221H possibly damaging Het
Zfp386 T A 12: 116,059,550 L296* probably null Het
Other mutations in Cyp2a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Cyp2a4 APN 7 26308544 missense probably damaging 1.00
IGL01609:Cyp2a4 APN 7 26308663 critical splice donor site probably null
IGL01959:Cyp2a4 APN 7 26307708 missense probably damaging 1.00
IGL02282:Cyp2a4 APN 7 26309047 missense probably benign 0.01
IGL03053:Cyp2a4 APN 7 26313550 splice site probably benign
IGL03168:Cyp2a4 APN 7 26313550 splice site probably benign
R0393:Cyp2a4 UTSW 7 26312868 missense possibly damaging 0.67
R0453:Cyp2a4 UTSW 7 26312833 missense probably benign 0.22
R0825:Cyp2a4 UTSW 7 26312916 missense probably benign 0.07
R0948:Cyp2a4 UTSW 7 26310788 missense probably damaging 1.00
R1215:Cyp2a4 UTSW 7 26314801 missense possibly damaging 0.75
R1222:Cyp2a4 UTSW 7 26308588 missense possibly damaging 0.70
R1374:Cyp2a4 UTSW 7 26312923 missense probably damaging 0.99
R1473:Cyp2a4 UTSW 7 26314763 missense probably benign
R1580:Cyp2a4 UTSW 7 26307651 missense possibly damaging 0.91
R1768:Cyp2a4 UTSW 7 26312772 missense possibly damaging 0.94
R1832:Cyp2a4 UTSW 7 26312210 missense probably damaging 0.99
R1911:Cyp2a4 UTSW 7 26308974 missense possibly damaging 0.85
R2080:Cyp2a4 UTSW 7 26308537 missense possibly damaging 0.96
R2086:Cyp2a4 UTSW 7 26312308 missense probably damaging 1.00
R2259:Cyp2a4 UTSW 7 26309035 missense probably damaging 0.99
R2877:Cyp2a4 UTSW 7 26312187 missense possibly damaging 0.95
R2878:Cyp2a4 UTSW 7 26312187 missense possibly damaging 0.95
R3732:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3732:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3733:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3734:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R4079:Cyp2a4 UTSW 7 26307366 missense probably benign 0.22
R4297:Cyp2a4 UTSW 7 26307368 missense probably damaging 0.96
R4785:Cyp2a4 UTSW 7 26312875 missense probably damaging 1.00
R4998:Cyp2a4 UTSW 7 26307361 missense probably damaging 1.00
R5297:Cyp2a4 UTSW 7 26312204 missense probably benign 0.07
R5893:Cyp2a4 UTSW 7 26308928 missense probably damaging 1.00
R5942:Cyp2a4 UTSW 7 26310704 critical splice acceptor site probably null
R6262:Cyp2a4 UTSW 7 26312230 missense probably damaging 0.99
R6612:Cyp2a4 UTSW 7 26308647 missense probably benign 0.00
R6722:Cyp2a4 UTSW 7 26313558 missense probably benign 0.04
R7064:Cyp2a4 UTSW 7 26312307 missense probably benign 0.02
R7419:Cyp2a4 UTSW 7 26314763 missense probably benign 0.00
R7562:Cyp2a4 UTSW 7 26312896 missense possibly damaging 0.88
Z1176:Cyp2a4 UTSW 7 26307323 nonsense probably null
Z1176:Cyp2a4 UTSW 7 26310841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCCACCAGATCTCTTCAG -3'
(R):5'- ACAGCGGATATCAGCGTGTG -3'

Sequencing Primer
(F):5'- ACCAGATCTCTTCAGTCTCCTG -3'
(R):5'- CTATCCTGGGACATGGTATGG -3'
Posted On2015-03-18