Incidental Mutation 'R3741:Syngr4'
ID270367
Institutional Source Beutler Lab
Gene Symbol Syngr4
Ensembl Gene ENSMUSG00000040231
Gene Namesynaptogyrin 4
Synonyms
MMRRC Submission 040727-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R3741 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45885222-45896714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45895770 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 5 (E5G)
Ref Sequence ENSEMBL: ENSMUSP00000113955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039049] [ENSMUST00000069772] [ENSMUST00000120299] [ENSMUST00000209350] [ENSMUST00000210503]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039049
AA Change: E5G

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047035
Gene: ENSMUSG00000040231
AA Change: E5G

DomainStartEndE-ValueType
Pfam:MARVEL 18 163 2e-27 PFAM
low complexity region 184 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069772
SMART Domains Protein: ENSMUSP00000070405
Gene: ENSMUSG00000002781

DomainStartEndE-ValueType
Pfam:DUF3754 182 349 3.6e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120299
AA Change: E5G

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113955
Gene: ENSMUSG00000040231
AA Change: E5G

DomainStartEndE-ValueType
Pfam:MARVEL 18 110 2.3e-12 PFAM
low complexity region 113 129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150842
AA Change: K71E
Predicted Effect probably benign
Transcript: ENSMUST00000209292
Predicted Effect probably benign
Transcript: ENSMUST00000209350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210044
Predicted Effect probably benign
Transcript: ENSMUST00000210503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211254
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein. The gene belongs to the synaptogyrin gene family. Like other members of the family the protein contains four transmembrane regions. The exact function of this protein is unclear. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,478,619 V1748A possibly damaging Het
Atp10b A T 11: 43,235,662 S1082C probably damaging Het
Atp8b2 C G 3: 89,946,031 A726P probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bbip1 T C 19: 53,932,175 M1V probably null Het
Bbox1 A G 2: 110,305,577 I19T possibly damaging Het
Bclaf3 T A X: 159,551,832 H41Q probably benign Het
Ctsm T A 13: 61,539,627 Q107L probably benign Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Cyp2a4 A C 7: 26,308,544 K125N probably damaging Het
Dapk1 T C 13: 60,748,200 S701P probably benign Het
Dnah1 A G 14: 31,265,467 probably benign Het
Dnah11 A G 12: 118,131,341 M718T probably benign Het
Dnah2 C A 11: 69,448,469 A3071S probably damaging Het
Epb41l4a A T 18: 33,828,102 probably null Het
Fam135a A T 1: 24,014,811 M1215K probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Hhipl1 A G 12: 108,318,717 Y443C probably damaging Het
Hoxc13 G A 15: 102,921,438 G84D possibly damaging Het
Ifi207 T C 1: 173,727,562 I851M probably damaging Het
Lipk T G 19: 34,021,707 L134R probably damaging Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Msrb3 A T 10: 120,784,214 F67I probably damaging Het
Myo1a A G 10: 127,714,898 D593G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Optn C A 2: 5,034,198 M371I possibly damaging Het
Rims1 A T 1: 22,373,443 V380D probably damaging Het
Rnf148 A G 6: 23,654,065 C311R possibly damaging Het
Rrp12 T C 19: 41,885,728 D377G probably damaging Het
Sbp T A 17: 23,945,582 probably benign Het
Sipa1 T C 19: 5,654,857 E570G probably damaging Het
Spem2 T C 11: 69,816,730 R470G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Ttn T A 2: 76,790,359 K13995* probably null Het
Vmn1r69 A G 7: 10,580,142 Y221H possibly damaging Het
Zfp386 T A 12: 116,059,550 L296* probably null Het
Other mutations in Syngr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Syngr4 APN 7 45886966 missense probably benign
R1739:Syngr4 UTSW 7 45888722 missense possibly damaging 0.95
R2143:Syngr4 UTSW 7 45887040 missense probably benign 0.01
R2144:Syngr4 UTSW 7 45887040 missense probably benign 0.01
R2145:Syngr4 UTSW 7 45887040 missense probably benign 0.01
R3740:Syngr4 UTSW 7 45895770 missense possibly damaging 0.94
R3742:Syngr4 UTSW 7 45895770 missense possibly damaging 0.94
R4627:Syngr4 UTSW 7 45887028 missense probably damaging 1.00
R6709:Syngr4 UTSW 7 45888698 missense probably benign 0.02
R6767:Syngr4 UTSW 7 45887491 missense possibly damaging 0.58
R7207:Syngr4 UTSW 7 45888677 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CAGTGGCTAGTGACCAGATACTC -3'
(R):5'- CAAAGGAAGGGCCAGTACTC -3'

Sequencing Primer
(F):5'- CCAGATACTCAGTAAAAGGTGGCTTC -3'
(R):5'- GAAGGGCCAGTACTCCCCAC -3'
Posted On2015-03-18