Incidental Mutation 'R3741:Msrb3'
ID270371
Institutional Source Beutler Lab
Gene Symbol Msrb3
Ensembl Gene ENSMUSG00000051236
Gene Namemethionine sulfoxide reductase B3
Synonyms
MMRRC Submission 040727-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R3741 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location120781096-120899101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120784214 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 67 (F67I)
Ref Sequence ENSEMBL: ENSMUSP00000115269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092143] [ENSMUST00000130950]
Predicted Effect probably damaging
Transcript: ENSMUST00000092143
AA Change: F139I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000089781
Gene: ENSMUSG00000051236
AA Change: F139I

DomainStartEndE-ValueType
Pfam:SelR 41 161 1.9e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130950
AA Change: F67I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115269
Gene: ENSMUSG00000051236
AA Change: F67I

DomainStartEndE-ValueType
Pfam:SelR 20 90 7.1e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139961
Meta Mutation Damage Score 0.9672 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the reduction of methionine sulfoxide to methionine. This enzyme acts as a monomer and requires zinc as a cofactor. Several transcript variants encoding two different isoforms have been found for this gene. One of the isoforms localizes to mitochondria while the other localizes to endoplasmic reticula. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit deafness with cochlear inner and outer hair cell degeneration and increased apoptosis in the organ of Corti. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,478,619 V1748A possibly damaging Het
Atp10b A T 11: 43,235,662 S1082C probably damaging Het
Atp8b2 C G 3: 89,946,031 A726P probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bbip1 T C 19: 53,932,175 M1V probably null Het
Bbox1 A G 2: 110,305,577 I19T possibly damaging Het
Bclaf3 T A X: 159,551,832 H41Q probably benign Het
Ctsm T A 13: 61,539,627 Q107L probably benign Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Cyp2a4 A C 7: 26,308,544 K125N probably damaging Het
Dapk1 T C 13: 60,748,200 S701P probably benign Het
Dnah1 A G 14: 31,265,467 probably benign Het
Dnah11 A G 12: 118,131,341 M718T probably benign Het
Dnah2 C A 11: 69,448,469 A3071S probably damaging Het
Epb41l4a A T 18: 33,828,102 probably null Het
Fam135a A T 1: 24,014,811 M1215K probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Hhipl1 A G 12: 108,318,717 Y443C probably damaging Het
Hoxc13 G A 15: 102,921,438 G84D possibly damaging Het
Ifi207 T C 1: 173,727,562 I851M probably damaging Het
Lipk T G 19: 34,021,707 L134R probably damaging Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Myo1a A G 10: 127,714,898 D593G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Optn C A 2: 5,034,198 M371I possibly damaging Het
Rims1 A T 1: 22,373,443 V380D probably damaging Het
Rnf148 A G 6: 23,654,065 C311R possibly damaging Het
Rrp12 T C 19: 41,885,728 D377G probably damaging Het
Sbp T A 17: 23,945,582 probably benign Het
Sipa1 T C 19: 5,654,857 E570G probably damaging Het
Spem2 T C 11: 69,816,730 R470G possibly damaging Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Ttn T A 2: 76,790,359 K13995* probably null Het
Vmn1r69 A G 7: 10,580,142 Y221H possibly damaging Het
Zfp386 T A 12: 116,059,550 L296* probably null Het
Other mutations in Msrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02546:Msrb3 APN 10 120850001 missense possibly damaging 0.94
IGL03303:Msrb3 APN 10 120784141 missense probably benign 0.03
R0138:Msrb3 UTSW 10 120851987 missense probably damaging 1.00
R1073:Msrb3 UTSW 10 120784136 missense possibly damaging 0.96
R1946:Msrb3 UTSW 10 120852008 missense probably damaging 1.00
R2113:Msrb3 UTSW 10 120852080 missense possibly damaging 0.66
R3623:Msrb3 UTSW 10 120784198 missense probably damaging 1.00
R4606:Msrb3 UTSW 10 120849997 missense probably damaging 1.00
R6397:Msrb3 UTSW 10 120791451 missense probably damaging 1.00
R6875:Msrb3 UTSW 10 120784106 missense probably benign 0.13
R7207:Msrb3 UTSW 10 120791400 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAACACTTTGTTTTCACCGC -3'
(R):5'- TGTCTGATATGCACAATTCGAGTG -3'

Sequencing Primer
(F):5'- GCTACCCCTGATTTTACAGCTCAG -3'
(R):5'- AAAGTCTGTCTGGAGCCATC -3'
Posted On2015-03-18