Incidental Mutation 'R3741:Nsf'
ID 270376
Institutional Source Beutler Lab
Gene Symbol Nsf
Ensembl Gene ENSMUSG00000034187
Gene Name N-ethylmaleimide sensitive fusion protein
Synonyms N-ethylmaleimide sensitive factor, SKD2
MMRRC Submission 040727-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3741 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 103712608-103844882 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103821578 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 26 (E26K)
Ref Sequence ENSEMBL: ENSMUSP00000099364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103075] [ENSMUST00000133774] [ENSMUST00000149642]
AlphaFold P46460
Predicted Effect possibly damaging
Transcript: ENSMUST00000103075
AA Change: E26K

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099364
Gene: ENSMUSG00000034187
AA Change: E26K

DomainStartEndE-ValueType
CDC48_N 5 86 2.7e-16 SMART
CDC48_2 111 183 6.22e-7 SMART
AAA 252 399 3.65e-19 SMART
AAA 535 671 2.2e-13 SMART
low complexity region 674 683 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107009
Predicted Effect probably benign
Transcript: ENSMUST00000133774
SMART Domains Protein: ENSMUSP00000133591
Gene: ENSMUSG00000034187

DomainStartEndE-ValueType
Pfam:CDC48_N 1 51 1.5e-10 PFAM
CDC48_2 76 148 6.22e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145126
Predicted Effect possibly damaging
Transcript: ENSMUST00000149642
AA Change: E23K

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133603
Gene: ENSMUSG00000034187
AA Change: E23K

DomainStartEndE-ValueType
CDC48_N 2 76 6.51e-10 SMART
Meta Mutation Damage Score 0.0893 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,406,357 (GRCm39) V1748A possibly damaging Het
Atp10b A T 11: 43,126,489 (GRCm39) S1082C probably damaging Het
Atp8b2 C G 3: 89,853,338 (GRCm39) A726P probably benign Het
B4galt3 C A 1: 171,101,613 (GRCm39) H196N probably damaging Het
Bbip1 T C 19: 53,920,606 (GRCm39) M1V probably null Het
Bbox1 A G 2: 110,135,922 (GRCm39) I19T possibly damaging Het
Bclaf3 T A X: 158,334,828 (GRCm39) H41Q probably benign Het
Ctsm T A 13: 61,687,441 (GRCm39) Q107L probably benign Het
Ctso G A 3: 81,859,556 (GRCm39) V288I probably benign Het
Cyp2a4 A C 7: 26,007,969 (GRCm39) K125N probably damaging Het
Dapk1 T C 13: 60,896,014 (GRCm39) S701P probably benign Het
Dnah1 A G 14: 30,987,424 (GRCm39) probably benign Het
Dnah11 A G 12: 118,095,076 (GRCm39) M718T probably benign Het
Dnah2 C A 11: 69,339,295 (GRCm39) A3071S probably damaging Het
Epb41l4a A T 18: 33,961,155 (GRCm39) probably null Het
Fam135a A T 1: 24,053,892 (GRCm39) M1215K probably damaging Het
Gm6489 T A 1: 31,326,764 (GRCm39) noncoding transcript Het
Hhipl1 A G 12: 108,284,976 (GRCm39) Y443C probably damaging Het
Hoxc13 G A 15: 102,829,873 (GRCm39) G84D possibly damaging Het
Ifi207 T C 1: 173,555,128 (GRCm39) I851M probably damaging Het
Lipk T G 19: 33,999,107 (GRCm39) L134R probably damaging Het
Mov10l1 A G 15: 88,896,345 (GRCm39) N678D possibly damaging Het
Msrb3 A T 10: 120,620,119 (GRCm39) F67I probably damaging Het
Myo1a A G 10: 127,550,767 (GRCm39) D593G probably benign Het
Nup210l A T 3: 90,114,701 (GRCm39) M1759L probably benign Het
Optn C A 2: 5,039,009 (GRCm39) M371I possibly damaging Het
Rims1 A T 1: 22,443,667 (GRCm39) V380D probably damaging Het
Rnf148 A G 6: 23,654,064 (GRCm39) C311R possibly damaging Het
Rrp12 T C 19: 41,874,167 (GRCm39) D377G probably damaging Het
Sbp T A 17: 24,164,556 (GRCm39) probably benign Het
Sipa1 T C 19: 5,704,885 (GRCm39) E570G probably damaging Het
Spem2 T C 11: 69,707,556 (GRCm39) R470G possibly damaging Het
Syngr4 T C 7: 45,545,194 (GRCm39) E5G possibly damaging Het
Tmem88b A G 4: 155,869,884 (GRCm39) L59P probably damaging Het
Ttn T A 2: 76,620,703 (GRCm39) K13995* probably null Het
Vmn1r69 A G 7: 10,314,069 (GRCm39) Y221H possibly damaging Het
Zfp386 T A 12: 116,023,170 (GRCm39) L296* probably null Het
Other mutations in Nsf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Nsf APN 11 103,752,711 (GRCm39) splice site probably benign
IGL01377:Nsf APN 11 103,763,473 (GRCm39) missense probably damaging 0.97
IGL01994:Nsf APN 11 103,819,608 (GRCm39) missense probably damaging 0.98
IGL02141:Nsf APN 11 103,719,351 (GRCm39) missense probably benign 0.02
IGL02663:Nsf APN 11 103,821,641 (GRCm39) missense probably benign 0.04
IGL02871:Nsf APN 11 103,752,882 (GRCm39) splice site probably benign
uhaul UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R0180:Nsf UTSW 11 103,821,606 (GRCm39) missense probably damaging 1.00
R0880:Nsf UTSW 11 103,804,198 (GRCm39) missense possibly damaging 0.72
R1146:Nsf UTSW 11 103,719,364 (GRCm39) missense probably damaging 1.00
R1146:Nsf UTSW 11 103,719,364 (GRCm39) missense probably damaging 1.00
R1203:Nsf UTSW 11 103,816,952 (GRCm39) unclassified probably benign
R1873:Nsf UTSW 11 103,749,843 (GRCm39) missense probably damaging 1.00
R1951:Nsf UTSW 11 103,773,702 (GRCm39) nonsense probably null
R2163:Nsf UTSW 11 103,754,159 (GRCm39) missense possibly damaging 0.64
R2193:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2194:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2287:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2289:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2343:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2345:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2346:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2347:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2350:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2405:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2406:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2407:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2408:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2409:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2411:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2435:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2924:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2925:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R2987:Nsf UTSW 11 103,749,869 (GRCm39) splice site probably null
R3177:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R3277:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R3742:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R3845:Nsf UTSW 11 103,821,578 (GRCm39) missense possibly damaging 0.59
R4278:Nsf UTSW 11 103,821,632 (GRCm39) missense probably damaging 0.96
R4717:Nsf UTSW 11 103,714,595 (GRCm39) missense probably damaging 1.00
R4775:Nsf UTSW 11 103,763,419 (GRCm39) missense possibly damaging 0.93
R4915:Nsf UTSW 11 103,801,185 (GRCm39) unclassified probably benign
R4918:Nsf UTSW 11 103,801,185 (GRCm39) unclassified probably benign
R5090:Nsf UTSW 11 103,801,404 (GRCm39) missense probably benign 0.00
R5126:Nsf UTSW 11 103,773,618 (GRCm39) nonsense probably null
R5411:Nsf UTSW 11 103,773,637 (GRCm39) missense probably damaging 1.00
R5560:Nsf UTSW 11 103,754,081 (GRCm39) missense possibly damaging 0.47
R6344:Nsf UTSW 11 103,752,730 (GRCm39) missense probably damaging 1.00
R6596:Nsf UTSW 11 103,801,283 (GRCm39) missense probably damaging 0.98
R7155:Nsf UTSW 11 103,719,356 (GRCm39) nonsense probably null
R7272:Nsf UTSW 11 103,718,064 (GRCm39) missense probably damaging 1.00
R7769:Nsf UTSW 11 103,819,665 (GRCm39) missense probably damaging 1.00
R8323:Nsf UTSW 11 103,819,665 (GRCm39) missense probably benign 0.05
R8487:Nsf UTSW 11 103,819,584 (GRCm39) missense probably damaging 1.00
R8856:Nsf UTSW 11 103,821,568 (GRCm39) missense possibly damaging 0.69
R9253:Nsf UTSW 11 103,804,142 (GRCm39) missense probably null 1.00
R9476:Nsf UTSW 11 103,763,988 (GRCm39) missense probably damaging 1.00
R9509:Nsf UTSW 11 103,754,074 (GRCm39) missense probably benign 0.19
R9510:Nsf UTSW 11 103,763,988 (GRCm39) missense probably damaging 1.00
R9520:Nsf UTSW 11 103,804,709 (GRCm39) missense probably damaging 1.00
R9546:Nsf UTSW 11 103,801,275 (GRCm39) nonsense probably null
R9632:Nsf UTSW 11 103,714,594 (GRCm39) missense probably damaging 1.00
R9779:Nsf UTSW 11 103,719,352 (GRCm39) missense probably damaging 0.99
X0066:Nsf UTSW 11 103,714,566 (GRCm39) missense probably benign
Z1176:Nsf UTSW 11 103,801,380 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGTTTGACAGTGTAATGACAG -3'
(R):5'- CTACCCTGGAGGAAGAAACACG -3'

Sequencing Primer
(F):5'- GTTTGACAGTGTAATGACAGAAATGC -3'
(R):5'- TCAGGATGGAGGGACATTTACTAC -3'
Posted On 2015-03-18