Incidental Mutation 'R3741:Zfp386'
ID270379
Institutional Source Beutler Lab
Gene Symbol Zfp386
Ensembl Gene ENSMUSG00000042063
Gene Namezinc finger protein 386 (Kruppel-like)
Synonyms
MMRRC Submission 040727-MU
Accession Numbers

Genbank: NM_001004066, NM_019565

Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R3741 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location116047724-116063360 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 116059550 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 296 (L296*)
Ref Sequence ENSEMBL: ENSMUSP00000138305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073551] [ENSMUST00000183125]
Predicted Effect probably null
Transcript: ENSMUST00000073551
AA Change: L261*
SMART Domains Protein: ENSMUSP00000073241
Gene: ENSMUSG00000042063
AA Change: L261*

DomainStartEndE-ValueType
KRAB 6 66 1.88e-19 SMART
ZnF_C2H2 379 401 4.72e-2 SMART
ZnF_C2H2 407 429 6.42e-4 SMART
ZnF_C2H2 435 457 5.14e-3 SMART
ZnF_C2H2 463 485 2.09e-3 SMART
ZnF_C2H2 491 513 6.42e-4 SMART
ZnF_C2H2 519 541 4.87e-4 SMART
ZnF_C2H2 547 569 1.28e-3 SMART
ZnF_C2H2 575 597 2.2e-2 SMART
ZnF_C2H2 603 625 5.99e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182566
Predicted Effect probably null
Transcript: ENSMUST00000183125
AA Change: L296*
SMART Domains Protein: ENSMUSP00000138305
Gene: ENSMUSG00000042063
AA Change: L296*

DomainStartEndE-ValueType
KRAB 6 66 1.88e-19 SMART
ZnF_C2H2 379 401 4.72e-2 SMART
ZnF_C2H2 407 429 6.42e-4 SMART
ZnF_C2H2 435 457 5.14e-3 SMART
ZnF_C2H2 463 485 2.09e-3 SMART
ZnF_C2H2 491 513 6.42e-4 SMART
ZnF_C2H2 519 541 4.87e-4 SMART
ZnF_C2H2 547 569 1.28e-3 SMART
ZnF_C2H2 575 597 2.2e-2 SMART
ZnF_C2H2 603 625 5.99e-4 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,478,619 V1748A possibly damaging Het
Atp10b A T 11: 43,235,662 S1082C probably damaging Het
Atp8b2 C G 3: 89,946,031 A726P probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bbip1 T C 19: 53,932,175 M1V probably null Het
Bbox1 A G 2: 110,305,577 I19T possibly damaging Het
Bclaf3 T A X: 159,551,832 H41Q probably benign Het
Ctsm T A 13: 61,539,627 Q107L probably benign Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Cyp2a4 A C 7: 26,308,544 K125N probably damaging Het
Dapk1 T C 13: 60,748,200 S701P probably benign Het
Dnah1 A G 14: 31,265,467 probably benign Het
Dnah11 A G 12: 118,131,341 M718T probably benign Het
Dnah2 C A 11: 69,448,469 A3071S probably damaging Het
Epb41l4a A T 18: 33,828,102 probably null Het
Fam135a A T 1: 24,014,811 M1215K probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Hhipl1 A G 12: 108,318,717 Y443C probably damaging Het
Hoxc13 G A 15: 102,921,438 G84D possibly damaging Het
Ifi207 T C 1: 173,727,562 I851M probably damaging Het
Lipk T G 19: 34,021,707 L134R probably damaging Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Msrb3 A T 10: 120,784,214 F67I probably damaging Het
Myo1a A G 10: 127,714,898 D593G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Optn C A 2: 5,034,198 M371I possibly damaging Het
Rims1 A T 1: 22,373,443 V380D probably damaging Het
Rnf148 A G 6: 23,654,065 C311R possibly damaging Het
Rrp12 T C 19: 41,885,728 D377G probably damaging Het
Sbp T A 17: 23,945,582 probably benign Het
Sipa1 T C 19: 5,654,857 E570G probably damaging Het
Spem2 T C 11: 69,816,730 R470G possibly damaging Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Ttn T A 2: 76,790,359 K13995* probably null Het
Vmn1r69 A G 7: 10,580,142 Y221H possibly damaging Het
Other mutations in Zfp386
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Zfp386 APN 12 116059168 missense probably benign
IGL02692:Zfp386 APN 12 116059235 missense probably damaging 0.96
IGL03071:Zfp386 APN 12 116059140 missense probably benign 0.08
F5493:Zfp386 UTSW 12 116060302 missense probably damaging 0.99
R0098:Zfp386 UTSW 12 116059214 nonsense probably null
R0098:Zfp386 UTSW 12 116059214 nonsense probably null
R0372:Zfp386 UTSW 12 116054816 missense possibly damaging 0.71
R0784:Zfp386 UTSW 12 116059920 nonsense probably null
R0866:Zfp386 UTSW 12 116054709 splice site probably benign
R0947:Zfp386 UTSW 12 116059778 missense probably benign 0.11
R1080:Zfp386 UTSW 12 116059806 nonsense probably null
R1517:Zfp386 UTSW 12 116059605 missense possibly damaging 0.67
R1597:Zfp386 UTSW 12 116060089 missense probably damaging 0.99
R1722:Zfp386 UTSW 12 116059906 missense probably damaging 0.99
R2043:Zfp386 UTSW 12 116059161 missense probably benign 0.22
R3742:Zfp386 UTSW 12 116059550 nonsense probably null
R3902:Zfp386 UTSW 12 116060155 missense probably damaging 1.00
R5012:Zfp386 UTSW 12 116059244 missense probably benign
R5590:Zfp386 UTSW 12 116059727 missense probably benign 0.41
R5709:Zfp386 UTSW 12 116059685 missense probably benign 0.23
R6156:Zfp386 UTSW 12 116059906 missense probably damaging 0.99
R6184:Zfp386 UTSW 12 116060513 missense possibly damaging 0.64
R6423:Zfp386 UTSW 12 116060113 missense probably damaging 0.96
R8015:Zfp386 UTSW 12 116059407 missense probably damaging 0.96
R8120:Zfp386 UTSW 12 116054953 missense unknown
R8137:Zfp386 UTSW 12 116059648 missense possibly damaging 0.91
Z1088:Zfp386 UTSW 12 116054773 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGTCTCCTGTGGCCAAAAG -3'
(R):5'- ATGCTGAATTTTACGCCTAGTAACG -3'

Sequencing Primer
(F):5'- TGTGGCCAAAAGCACAATACTAATG -3'
(R):5'- ACATTGTGTCACAATCTATACTCTTG -3'
Posted On2015-03-18