Incidental Mutation 'R3741:Ctsm'
ID270382
Institutional Source Beutler Lab
Gene Symbol Ctsm
Ensembl Gene ENSMUSG00000074871
Gene Namecathepsin M
Synonyms1600027J17Rik, Catm, Cat M
MMRRC Submission 040727-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3741 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location61535743-61541839 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61539627 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 107 (Q107L)
Ref Sequence ENSEMBL: ENSMUSP00000153101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099451] [ENSMUST00000223778] [ENSMUST00000225268] [ENSMUST00000225902]
Predicted Effect probably benign
Transcript: ENSMUST00000099451
AA Change: Q107L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097050
Gene: ENSMUSG00000074871
AA Change: Q107L

DomainStartEndE-ValueType
Inhibitor_I29 29 88 4.63e-24 SMART
Pept_C1 114 332 2.05e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223778
AA Change: Q107L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000225268
Predicted Effect probably benign
Transcript: ENSMUST00000225902
Predicted Effect probably benign
Transcript: ENSMUST00000225965
Meta Mutation Damage Score 0.0755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,478,619 V1748A possibly damaging Het
Atp10b A T 11: 43,235,662 S1082C probably damaging Het
Atp8b2 C G 3: 89,946,031 A726P probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bbip1 T C 19: 53,932,175 M1V probably null Het
Bbox1 A G 2: 110,305,577 I19T possibly damaging Het
Bclaf3 T A X: 159,551,832 H41Q probably benign Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Cyp2a4 A C 7: 26,308,544 K125N probably damaging Het
Dapk1 T C 13: 60,748,200 S701P probably benign Het
Dnah1 A G 14: 31,265,467 probably benign Het
Dnah11 A G 12: 118,131,341 M718T probably benign Het
Dnah2 C A 11: 69,448,469 A3071S probably damaging Het
Epb41l4a A T 18: 33,828,102 probably null Het
Fam135a A T 1: 24,014,811 M1215K probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Hhipl1 A G 12: 108,318,717 Y443C probably damaging Het
Hoxc13 G A 15: 102,921,438 G84D possibly damaging Het
Ifi207 T C 1: 173,727,562 I851M probably damaging Het
Lipk T G 19: 34,021,707 L134R probably damaging Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Msrb3 A T 10: 120,784,214 F67I probably damaging Het
Myo1a A G 10: 127,714,898 D593G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Optn C A 2: 5,034,198 M371I possibly damaging Het
Rims1 A T 1: 22,373,443 V380D probably damaging Het
Rnf148 A G 6: 23,654,065 C311R possibly damaging Het
Rrp12 T C 19: 41,885,728 D377G probably damaging Het
Sbp T A 17: 23,945,582 probably benign Het
Sipa1 T C 19: 5,654,857 E570G probably damaging Het
Spem2 T C 11: 69,816,730 R470G possibly damaging Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Ttn T A 2: 76,790,359 K13995* probably null Het
Vmn1r69 A G 7: 10,580,142 Y221H possibly damaging Het
Zfp386 T A 12: 116,059,550 L296* probably null Het
Other mutations in Ctsm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01460:Ctsm APN 13 61539036 missense probably damaging 1.00
IGL01487:Ctsm APN 13 61539069 missense probably benign 0.08
IGL01647:Ctsm APN 13 61540273 missense probably benign 0.11
IGL01746:Ctsm APN 13 61539816 missense probably benign 0.07
IGL01746:Ctsm APN 13 61538903 splice site probably benign
IGL01908:Ctsm APN 13 61537787 missense probably benign 0.29
IGL02315:Ctsm APN 13 61539648 missense probably benign
FR4548:Ctsm UTSW 13 61537837 frame shift probably null
FR4976:Ctsm UTSW 13 61537836 frame shift probably null
R0613:Ctsm UTSW 13 61539682 missense probably damaging 0.97
R1631:Ctsm UTSW 13 61538435 missense possibly damaging 0.46
R3004:Ctsm UTSW 13 61539868 missense possibly damaging 0.60
R4631:Ctsm UTSW 13 61537696 missense probably null 1.00
R4889:Ctsm UTSW 13 61538401 missense probably damaging 1.00
R4989:Ctsm UTSW 13 61538962 missense probably damaging 1.00
R5478:Ctsm UTSW 13 61537729 missense probably benign 0.01
R6994:Ctsm UTSW 13 61539884 missense probably damaging 1.00
R7479:Ctsm UTSW 13 61537755 missense probably damaging 1.00
R8152:Ctsm UTSW 13 61539649 missense probably benign
R8696:Ctsm UTSW 13 61537707 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAATACTAAGGTAATGGTGGGTG -3'
(R):5'- GGTGACTGTGACACATACAGC -3'

Sequencing Primer
(F):5'- GTGGGTGAAATGATTGATATGCC -3'
(R):5'- GTGACACATACAGCATCACAATGTTG -3'
Posted On2015-03-18