Incidental Mutation 'R3741:Mov10l1'
ID270384
Institutional Source Beutler Lab
Gene Symbol Mov10l1
Ensembl Gene ENSMUSG00000015365
Gene NameMoloney leukemia virus 10-like 1
SynonymsCsm, CHAMP
MMRRC Submission 040727-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R3741 (G1)
Quality Score86
Status Validated
Chromosome15
Chromosomal Location88982909-89055152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89012142 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 678 (N678D)
Ref Sequence ENSEMBL: ENSMUSP00000015509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015509] [ENSMUST00000146993]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015509
AA Change: N678D

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000015509
Gene: ENSMUSG00000015365
AA Change: N678D

DomainStartEndE-ValueType
low complexity region 52 65 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
Blast:AAA 444 526 2e-7 BLAST
internal_repeat_1 615 651 5.23e-10 PROSPERO
internal_repeat_1 648 696 5.23e-10 PROSPERO
Pfam:AAA_11 746 852 1.4e-17 PFAM
Pfam:AAA_30 746 933 5e-11 PFAM
Pfam:AAA_19 754 826 1.5e-10 PFAM
Pfam:AAA_11 855 928 1.3e-18 PFAM
Pfam:AAA_12 935 1152 3.7e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000146993
AA Change: N730D

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118437
Gene: ENSMUSG00000015365
AA Change: N730D

DomainStartEndE-ValueType
low complexity region 104 117 N/A INTRINSIC
low complexity region 390 401 N/A INTRINSIC
Blast:AAA 496 578 2e-7 BLAST
internal_repeat_1 667 703 6.08e-10 PROSPERO
internal_repeat_1 700 748 6.08e-10 PROSPERO
Pfam:AAA_11 798 903 1e-15 PFAM
Pfam:AAA_30 798 985 1.8e-11 PFAM
Pfam:AAA_19 806 878 7e-11 PFAM
Pfam:AAA_11 907 980 3.2e-17 PFAM
Pfam:AAA_12 987 1204 1.4e-43 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a putative RNA helicase and shows testis-specific expression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a targeted allele lacking the helicase domain exhibit male infertility due to meiotic arrest, apoptosis, and derepression of retrotransposons in male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,478,619 V1748A possibly damaging Het
Atp10b A T 11: 43,235,662 S1082C probably damaging Het
Atp8b2 C G 3: 89,946,031 A726P probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bbip1 T C 19: 53,932,175 M1V probably null Het
Bbox1 A G 2: 110,305,577 I19T possibly damaging Het
Bclaf3 T A X: 159,551,832 H41Q probably benign Het
Ctsm T A 13: 61,539,627 Q107L probably benign Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Cyp2a4 A C 7: 26,308,544 K125N probably damaging Het
Dapk1 T C 13: 60,748,200 S701P probably benign Het
Dnah1 A G 14: 31,265,467 probably benign Het
Dnah11 A G 12: 118,131,341 M718T probably benign Het
Dnah2 C A 11: 69,448,469 A3071S probably damaging Het
Epb41l4a A T 18: 33,828,102 probably null Het
Fam135a A T 1: 24,014,811 M1215K probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Hhipl1 A G 12: 108,318,717 Y443C probably damaging Het
Hoxc13 G A 15: 102,921,438 G84D possibly damaging Het
Ifi207 T C 1: 173,727,562 I851M probably damaging Het
Lipk T G 19: 34,021,707 L134R probably damaging Het
Msrb3 A T 10: 120,784,214 F67I probably damaging Het
Myo1a A G 10: 127,714,898 D593G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Optn C A 2: 5,034,198 M371I possibly damaging Het
Rims1 A T 1: 22,373,443 V380D probably damaging Het
Rnf148 A G 6: 23,654,065 C311R possibly damaging Het
Rrp12 T C 19: 41,885,728 D377G probably damaging Het
Sbp T A 17: 23,945,582 probably benign Het
Sipa1 T C 19: 5,654,857 E570G probably damaging Het
Spem2 T C 11: 69,816,730 R470G possibly damaging Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Ttn T A 2: 76,790,359 K13995* probably null Het
Vmn1r69 A G 7: 10,580,142 Y221H possibly damaging Het
Zfp386 T A 12: 116,059,550 L296* probably null Het
Other mutations in Mov10l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Mov10l1 APN 15 88994989 missense probably damaging 1.00
IGL01110:Mov10l1 APN 15 89021257 missense probably benign 0.05
IGL01369:Mov10l1 APN 15 89024837 splice site probably benign
IGL01531:Mov10l1 APN 15 89054352 missense probably damaging 0.99
IGL01712:Mov10l1 APN 15 89024766 missense probably damaging 0.98
IGL02330:Mov10l1 APN 15 89026490 missense probably damaging 1.00
IGL02540:Mov10l1 APN 15 89018211 missense probably benign
IGL02938:Mov10l1 APN 15 88988526 missense probably damaging 1.00
R0382:Mov10l1 UTSW 15 88985593 missense possibly damaging 0.96
R0437:Mov10l1 UTSW 15 89005312 missense probably damaging 0.96
R0504:Mov10l1 UTSW 15 88998839 missense probably damaging 1.00
R0538:Mov10l1 UTSW 15 88994860 missense possibly damaging 0.73
R0577:Mov10l1 UTSW 15 89005727 missense probably damaging 1.00
R0592:Mov10l1 UTSW 15 88998766 critical splice acceptor site probably null
R0972:Mov10l1 UTSW 15 89021279 missense probably damaging 0.99
R1386:Mov10l1 UTSW 15 89011386 missense possibly damaging 0.87
R1737:Mov10l1 UTSW 15 89011404 missense possibly damaging 0.79
R2120:Mov10l1 UTSW 15 89007627 missense probably benign 0.30
R3740:Mov10l1 UTSW 15 89012142 missense possibly damaging 0.92
R3846:Mov10l1 UTSW 15 89012142 missense possibly damaging 0.92
R3850:Mov10l1 UTSW 15 89005695 critical splice acceptor site probably null
R3964:Mov10l1 UTSW 15 89012163 missense probably benign 0.00
R3965:Mov10l1 UTSW 15 89012163 missense probably benign 0.00
R4049:Mov10l1 UTSW 15 88995032 splice site probably benign
R4836:Mov10l1 UTSW 15 89020269 missense possibly damaging 0.47
R5233:Mov10l1 UTSW 15 88983032 missense probably benign
R5466:Mov10l1 UTSW 15 88985701 critical splice donor site probably null
R5552:Mov10l1 UTSW 15 89054366 critical splice donor site probably null
R5780:Mov10l1 UTSW 15 89011978 missense probably benign
R6275:Mov10l1 UTSW 15 89026620 missense probably damaging 0.99
R6326:Mov10l1 UTSW 15 88994895 missense probably damaging 1.00
R6652:Mov10l1 UTSW 15 88993902 missense probably damaging 1.00
R6793:Mov10l1 UTSW 15 88996184 missense possibly damaging 0.86
R7278:Mov10l1 UTSW 15 88993868 missense probably benign 0.18
R7733:Mov10l1 UTSW 15 89024801 missense probably damaging 0.99
R7998:Mov10l1 UTSW 15 89053439 missense probably damaging 1.00
R8260:Mov10l1 UTSW 15 89012110 missense probably benign
R8426:Mov10l1 UTSW 15 88997405 critical splice donor site probably null
Z1177:Mov10l1 UTSW 15 88996136 missense probably benign 0.36
Z1177:Mov10l1 UTSW 15 89018168 missense probably damaging 0.99
Z1177:Mov10l1 UTSW 15 89053411 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTTTACAGTCTCCTCAGGTGAC -3'
(R):5'- GACTATTTGTGAGTAACATTCCTCC -3'

Sequencing Primer
(F):5'- CTCCTCAGGTGACAGGGAATTG -3'
(R):5'- GTGAGTAACATTCCTCCTAAAAGTC -3'
Posted On2015-03-18