Incidental Mutation 'R3741:Hoxc13'
ID270385
Institutional Source Beutler Lab
Gene Symbol Hoxc13
Ensembl Gene ENSMUSG00000001655
Gene Namehomeobox C13
Synonyms
MMRRC Submission 040727-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3741 (G1)
Quality Score83
Status Validated
Chromosome15
Chromosomal Location102921103-102928814 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102921438 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 84 (G84D)
Ref Sequence ENSEMBL: ENSMUSP00000001700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001700]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001700
AA Change: G84D

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000001700
Gene: ENSMUSG00000001655
AA Change: G84D

DomainStartEndE-ValueType
low complexity region 22 50 N/A INTRINSIC
Pfam:HoxA13_N 52 166 1.7e-38 PFAM
HOX 258 320 6.12e-22 SMART
Meta Mutation Damage Score 0.0667 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. The product of this gene may play a role in the development of hair, nail, and filiform papilla. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit alopecia due to brittle hair, poor growth, abnormalities of caudal vertebrae, nails, and tongue filiform papillae, and lethality in the second week. Rare survivors recover, but lack hair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,478,619 V1748A possibly damaging Het
Atp10b A T 11: 43,235,662 S1082C probably damaging Het
Atp8b2 C G 3: 89,946,031 A726P probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bbip1 T C 19: 53,932,175 M1V probably null Het
Bbox1 A G 2: 110,305,577 I19T possibly damaging Het
Bclaf3 T A X: 159,551,832 H41Q probably benign Het
Ctsm T A 13: 61,539,627 Q107L probably benign Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Cyp2a4 A C 7: 26,308,544 K125N probably damaging Het
Dapk1 T C 13: 60,748,200 S701P probably benign Het
Dnah1 A G 14: 31,265,467 probably benign Het
Dnah11 A G 12: 118,131,341 M718T probably benign Het
Dnah2 C A 11: 69,448,469 A3071S probably damaging Het
Epb41l4a A T 18: 33,828,102 probably null Het
Fam135a A T 1: 24,014,811 M1215K probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Hhipl1 A G 12: 108,318,717 Y443C probably damaging Het
Ifi207 T C 1: 173,727,562 I851M probably damaging Het
Lipk T G 19: 34,021,707 L134R probably damaging Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Msrb3 A T 10: 120,784,214 F67I probably damaging Het
Myo1a A G 10: 127,714,898 D593G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Optn C A 2: 5,034,198 M371I possibly damaging Het
Rims1 A T 1: 22,373,443 V380D probably damaging Het
Rnf148 A G 6: 23,654,065 C311R possibly damaging Het
Rrp12 T C 19: 41,885,728 D377G probably damaging Het
Sbp T A 17: 23,945,582 probably benign Het
Sipa1 T C 19: 5,654,857 E570G probably damaging Het
Spem2 T C 11: 69,816,730 R470G possibly damaging Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Ttn T A 2: 76,790,359 K13995* probably null Het
Vmn1r69 A G 7: 10,580,142 Y221H possibly damaging Het
Zfp386 T A 12: 116,059,550 L296* probably null Het
Other mutations in Hoxc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02563:Hoxc13 APN 15 102921798 missense possibly damaging 0.76
R2125:Hoxc13 UTSW 15 102927223 missense probably damaging 1.00
R3742:Hoxc13 UTSW 15 102921438 missense possibly damaging 0.84
R3977:Hoxc13 UTSW 15 102921240 missense possibly damaging 0.60
R3978:Hoxc13 UTSW 15 102921240 missense possibly damaging 0.60
R6820:Hoxc13 UTSW 15 102921822 missense probably damaging 1.00
R7127:Hoxc13 UTSW 15 102921468 missense possibly damaging 0.87
R7719:Hoxc13 UTSW 15 102921858 missense possibly damaging 0.77
R8204:Hoxc13 UTSW 15 102927360 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGTCATGACGACTTCGCTG -3'
(R):5'- TCTGCTGCAGGTTCACGTTG -3'

Sequencing Primer
(F):5'- CCTTATGTACGTCTATGAGGACAGC -3'
(R):5'- CAGGTTCACGTTGTGCGACAG -3'
Posted On2015-03-18