Incidental Mutation 'R3741:Sipa1'
ID270387
Institutional Source Beutler Lab
Gene Symbol Sipa1
Ensembl Gene ENSMUSG00000056917
Gene Namesignal-induced proliferation associated gene 1
SynonymsSPA-1
MMRRC Submission 040727-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3741 (G1)
Quality Score221
Status Validated
Chromosome19
Chromosomal Location5651185-5663707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5654857 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 570 (E570G)
Ref Sequence ENSEMBL: ENSMUSP00000132345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071857] [ENSMUST00000080824] [ENSMUST00000164304] [ENSMUST00000169854]
Predicted Effect probably damaging
Transcript: ENSMUST00000071857
AA Change: E570G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073618
Gene: ENSMUSG00000056917
AA Change: E570G

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 529 7.2e-64 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000080824
AA Change: E570G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079637
Gene: ENSMUSG00000056917
AA Change: E570G

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164304
AA Change: E570G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128208
Gene: ENSMUSG00000056917
AA Change: E570G

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169854
AA Change: E570G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132345
Gene: ENSMUSG00000056917
AA Change: E570G

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Meta Mutation Damage Score 0.1239 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a mitogen induced GTPase activating protein (GAP). It exhibits a specific GAP activity for Ras-related regulatory proteins Rap1 and Rap2, but not for Ran or other small GTPases. This protein may also hamper mitogen-induced cell cycle progression when abnormally or prematurely expressed. It is localized to the perinuclear region. Two alternatively spliced variants encoding the same isoform have been characterized to date. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display chronic myelocytic leukemia in either the chronic phase or blast crisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,478,619 V1748A possibly damaging Het
Atp10b A T 11: 43,235,662 S1082C probably damaging Het
Atp8b2 C G 3: 89,946,031 A726P probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bbip1 T C 19: 53,932,175 M1V probably null Het
Bbox1 A G 2: 110,305,577 I19T possibly damaging Het
Bclaf3 T A X: 159,551,832 H41Q probably benign Het
Ctsm T A 13: 61,539,627 Q107L probably benign Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Cyp2a4 A C 7: 26,308,544 K125N probably damaging Het
Dapk1 T C 13: 60,748,200 S701P probably benign Het
Dnah1 A G 14: 31,265,467 probably benign Het
Dnah11 A G 12: 118,131,341 M718T probably benign Het
Dnah2 C A 11: 69,448,469 A3071S probably damaging Het
Epb41l4a A T 18: 33,828,102 probably null Het
Fam135a A T 1: 24,014,811 M1215K probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Hhipl1 A G 12: 108,318,717 Y443C probably damaging Het
Hoxc13 G A 15: 102,921,438 G84D possibly damaging Het
Ifi207 T C 1: 173,727,562 I851M probably damaging Het
Lipk T G 19: 34,021,707 L134R probably damaging Het
Mov10l1 A G 15: 89,012,142 N678D possibly damaging Het
Msrb3 A T 10: 120,784,214 F67I probably damaging Het
Myo1a A G 10: 127,714,898 D593G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Optn C A 2: 5,034,198 M371I possibly damaging Het
Rims1 A T 1: 22,373,443 V380D probably damaging Het
Rnf148 A G 6: 23,654,065 C311R possibly damaging Het
Rrp12 T C 19: 41,885,728 D377G probably damaging Het
Sbp T A 17: 23,945,582 probably benign Het
Spem2 T C 11: 69,816,730 R470G possibly damaging Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Ttn T A 2: 76,790,359 K13995* probably null Het
Vmn1r69 A G 7: 10,580,142 Y221H possibly damaging Het
Zfp386 T A 12: 116,059,550 L296* probably null Het
Other mutations in Sipa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01521:Sipa1 APN 19 5660978 start codon destroyed probably null 0.79
IGL01837:Sipa1 APN 19 5652071 missense probably damaging 0.98
IGL02858:Sipa1 APN 19 5655708 missense probably damaging 0.99
IGL03024:Sipa1 APN 19 5656161 missense probably damaging 1.00
R0277:Sipa1 UTSW 19 5654065 missense probably benign
R0831:Sipa1 UTSW 19 5660354 missense probably damaging 1.00
R0841:Sipa1 UTSW 19 5654807 missense probably benign 0.06
R1102:Sipa1 UTSW 19 5652754 missense probably benign
R1459:Sipa1 UTSW 19 5651664 missense probably damaging 1.00
R1460:Sipa1 UTSW 19 5651447 missense probably benign
R2422:Sipa1 UTSW 19 5652112 missense possibly damaging 0.47
R3924:Sipa1 UTSW 19 5660379 missense probably benign 0.05
R4231:Sipa1 UTSW 19 5654089 missense probably damaging 1.00
R4525:Sipa1 UTSW 19 5651957 missense probably benign 0.12
R4721:Sipa1 UTSW 19 5660385 missense probably damaging 0.99
R5176:Sipa1 UTSW 19 5659378 missense probably damaging 1.00
R5267:Sipa1 UTSW 19 5655758 missense probably benign 0.10
R5375:Sipa1 UTSW 19 5659612 missense probably damaging 0.99
R5480:Sipa1 UTSW 19 5659630 missense possibly damaging 0.68
R5582:Sipa1 UTSW 19 5654701 missense probably benign 0.00
R6005:Sipa1 UTSW 19 5656201 missense probably damaging 1.00
R6329:Sipa1 UTSW 19 5651489 missense probably damaging 1.00
R6712:Sipa1 UTSW 19 5660819 missense possibly damaging 0.69
R7209:Sipa1 UTSW 19 5654975 missense probably damaging 1.00
R7213:Sipa1 UTSW 19 5660523 missense probably damaging 1.00
R7665:Sipa1 UTSW 19 5651671 missense probably benign 0.00
R7881:Sipa1 UTSW 19 5651676 missense probably damaging 1.00
R7895:Sipa1 UTSW 19 5652662 missense probably benign
R8116:Sipa1 UTSW 19 5652112 missense possibly damaging 0.47
R8309:Sipa1 UTSW 19 5654936 missense probably damaging 0.99
R8708:Sipa1 UTSW 19 5660952 missense probably damaging 0.99
R8709:Sipa1 UTSW 19 5660952 missense probably damaging 0.99
X0057:Sipa1 UTSW 19 5654920 nonsense probably null
X0064:Sipa1 UTSW 19 5652736 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGAGAAGGTCCAGGCCAATAC -3'
(R):5'- GGCTAAGGCACTCAATGGTG -3'

Sequencing Primer
(F):5'- TCGCGACAGGCACAATTG -3'
(R):5'- CTCAATGGTGAGCAAGCGGC -3'
Posted On2015-03-18