Incidental Mutation 'R3742:B4galt3'
ID 270397
Institutional Source Beutler Lab
Gene Symbol B4galt3
Ensembl Gene ENSMUSG00000052423
Gene Name UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3
Synonyms ESTM26, 9530061M23Rik, beta4GalT-III, R74981
MMRRC Submission 040728-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.454) question?
Stock # R3742 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 171097898-171104468 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 171101613 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 196 (H196N)
Ref Sequence ENSEMBL: ENSMUSP00000106945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064272] [ENSMUST00000073120] [ENSMUST00000111313] [ENSMUST00000126699] [ENSMUST00000141999] [ENSMUST00000192956] [ENSMUST00000141114] [ENSMUST00000151863]
AlphaFold Q91YY2
Predicted Effect probably damaging
Transcript: ENSMUST00000064272
AA Change: H196N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066353
Gene: ENSMUSG00000052423
AA Change: H196N

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 212 1.7e-59 PFAM
Pfam:Glyco_transf_7C 217 294 6.3e-32 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073120
SMART Domains Protein: ENSMUSP00000072863
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 74 1.3e-9 PFAM
Pfam:Amino_oxidase 12 471 1.7e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111313
AA Change: H196N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106945
Gene: ENSMUSG00000052423
AA Change: H196N

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 214 2.1e-74 PFAM
Pfam:Glyco_transf_7C 217 294 1.7e-31 PFAM
Pfam:Glyco_tranf_2_2 238 298 1e-6 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125939
Predicted Effect probably benign
Transcript: ENSMUST00000126699
SMART Domains Protein: ENSMUSP00000141958
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
Pfam:Glyco_transf_7C 1 72 3.2e-28 PFAM
Pfam:Glyco_tranf_2_2 16 76 2.1e-5 PFAM
low complexity region 126 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138904
Predicted Effect probably benign
Transcript: ENSMUST00000141999
SMART Domains Protein: ENSMUSP00000114926
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192956
SMART Domains Protein: ENSMUSP00000141835
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 72 1.6e-7 PFAM
Pfam:Amino_oxidase 12 389 4.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141114
SMART Domains Protein: ENSMUSP00000114560
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
Pfam:Glyco_transf_7N 104 139 2.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151863
Meta Mutation Damage Score 0.5682 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene encodes an enzyme that may be mainly involved in the synthesis of the first N-acetyllactosamine unit of poly-N-acetyllactosamine chains. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b2 C G 3: 89,853,338 (GRCm39) A726P probably benign Het
Bclaf3 T A X: 158,334,828 (GRCm39) H41Q probably benign Het
Bsn C A 9: 107,982,938 (GRCm39) R3605M unknown Het
Ctso G A 3: 81,859,556 (GRCm39) V288I probably benign Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dnah11 A G 12: 118,095,076 (GRCm39) M718T probably benign Het
Dsg4 A T 18: 20,604,058 (GRCm39) T842S probably damaging Het
Epb41l5 T C 1: 119,532,973 (GRCm39) Q388R probably benign Het
Fbxo6 A G 4: 148,234,090 (GRCm39) probably benign Het
Frem1 A C 4: 82,930,104 (GRCm39) Y281D probably damaging Het
Gm6489 T A 1: 31,326,764 (GRCm39) noncoding transcript Het
Gtpbp2 A G 17: 46,476,808 (GRCm39) T329A probably benign Het
Hemgn T C 4: 46,396,421 (GRCm39) T272A possibly damaging Het
Hinfp A G 9: 44,213,812 (GRCm39) C22R probably damaging Het
Hoxc13 G A 15: 102,829,873 (GRCm39) G84D possibly damaging Het
Ing5 T A 1: 93,740,398 (GRCm39) S106R probably damaging Het
Mbd6 G A 10: 127,120,812 (GRCm39) probably benign Het
Nsf C T 11: 103,821,578 (GRCm39) E26K possibly damaging Het
Nup210l A T 3: 90,114,701 (GRCm39) M1759L probably benign Het
Or10ag52 A G 2: 87,043,340 (GRCm39) I35V probably benign Het
Or5b106 A G 19: 13,123,258 (GRCm39) F255S probably damaging Het
Or7e168 A T 9: 19,720,195 (GRCm39) I194F probably benign Het
Or7g25 A G 9: 19,159,979 (GRCm39) S239P possibly damaging Het
Pde4d T G 13: 109,877,013 (GRCm39) V53G probably benign Het
Shisa9 G A 16: 12,085,528 (GRCm39) R379Q probably damaging Het
Syngr4 T C 7: 45,545,194 (GRCm39) E5G possibly damaging Het
Tiam2 A G 17: 3,464,388 (GRCm39) D39G possibly damaging Het
Tmem88b A G 4: 155,869,884 (GRCm39) L59P probably damaging Het
Zfp386 T A 12: 116,023,170 (GRCm39) L296* probably null Het
Zfp605 G T 5: 110,276,564 (GRCm39) G561W probably damaging Het
Other mutations in B4galt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:B4galt3 APN 1 171,099,362 (GRCm39) missense probably damaging 1.00
BB004:B4galt3 UTSW 1 171,099,342 (GRCm39) nonsense probably null
BB014:B4galt3 UTSW 1 171,099,342 (GRCm39) nonsense probably null
R0026:B4galt3 UTSW 1 171,101,831 (GRCm39) unclassified probably benign
R0126:B4galt3 UTSW 1 171,103,738 (GRCm39) missense probably damaging 0.97
R0537:B4galt3 UTSW 1 171,101,821 (GRCm39) unclassified probably benign
R1478:B4galt3 UTSW 1 171,103,938 (GRCm39) missense probably benign 0.11
R2012:B4galt3 UTSW 1 171,100,118 (GRCm39) missense probably damaging 1.00
R2206:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R2207:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R2223:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R2353:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R2354:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R2438:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R2439:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3039:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3051:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3709:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3710:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3741:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3813:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3953:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4058:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4059:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4323:B4galt3 UTSW 1 171,103,515 (GRCm39) missense possibly damaging 0.93
R4367:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4368:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4370:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4371:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4486:B4galt3 UTSW 1 171,099,343 (GRCm39) missense possibly damaging 0.94
R4538:B4galt3 UTSW 1 171,100,280 (GRCm39) missense probably damaging 1.00
R5557:B4galt3 UTSW 1 171,100,089 (GRCm39) critical splice acceptor site probably null
R7313:B4galt3 UTSW 1 171,100,319 (GRCm39) missense probably damaging 1.00
R7927:B4galt3 UTSW 1 171,099,342 (GRCm39) nonsense probably null
R8222:B4galt3 UTSW 1 171,100,253 (GRCm39) missense possibly damaging 0.46
R8552:B4galt3 UTSW 1 171,101,917 (GRCm39) missense possibly damaging 0.70
R8804:B4galt3 UTSW 1 171,103,947 (GRCm39) missense probably benign 0.33
R8859:B4galt3 UTSW 1 171,099,241 (GRCm39) missense unknown
R9150:B4galt3 UTSW 1 171,103,899 (GRCm39) missense probably benign
R9265:B4galt3 UTSW 1 171,101,617 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTTGGGTGCTCTCTTCA -3'
(R):5'- TCCGCCAAAGTACTGGGG -3'

Sequencing Primer
(F):5'- GGGTGCTCTCTTCACTTTGGC -3'
(R):5'- AGATCCCTGCGGTTCACAAATTTG -3'
Posted On 2015-03-18