Incidental Mutation 'R3742:Atp8b2'
ID270401
Institutional Source Beutler Lab
Gene Symbol Atp8b2
Ensembl Gene ENSMUSG00000060671
Gene NameATPase, class I, type 8B, member 2
SynonymsId
MMRRC Submission 040728-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R3742 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89939481-89963508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 89946031 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Proline at position 726 (A726P)
Ref Sequence ENSEMBL: ENSMUSP00000128423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069805] [ENSMUST00000107396] [ENSMUST00000166502] [ENSMUST00000168276] [ENSMUST00000170739]
Predicted Effect probably benign
Transcript: ENSMUST00000069805
AA Change: A745P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063384
Gene: ENSMUSG00000060671
AA Change: A745P

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
low complexity region 80 96 N/A INTRINSIC
Pfam:E1-E2_ATPase 103 374 5.6e-18 PFAM
Pfam:HAD 408 842 1.3e-17 PFAM
Pfam:Hydrolase_like2 491 590 1e-11 PFAM
Pfam:Hydrolase 590 845 7.9e-8 PFAM
low complexity region 1133 1147 N/A INTRINSIC
low complexity region 1167 1190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107396
AA Change: A750P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103019
Gene: ENSMUSG00000060671
AA Change: A750P

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 1.3e-29 PFAM
Pfam:E1-E2_ATPase 81 351 2.7e-9 PFAM
Pfam:HAD 389 847 1.5e-17 PFAM
Pfam:Cation_ATPase 472 571 4.3e-12 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2e-84 PFAM
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1172 1195 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166347
Predicted Effect probably benign
Transcript: ENSMUST00000166502
SMART Domains Protein: ENSMUSP00000132201
Gene: ENSMUSG00000060671

DomainStartEndE-ValueType
SCOP:d1eula_ 2 95 5e-7 SMART
low complexity region 100 109 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167442
Predicted Effect probably benign
Transcript: ENSMUST00000168276
AA Change: A726P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128423
Gene: ENSMUSG00000060671
AA Change: A726P

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:E1-E2_ATPase 84 355 2.5e-18 PFAM
Pfam:HAD 389 823 7.9e-18 PFAM
Pfam:Hydrolase_like2 472 571 3.6e-12 PFAM
Pfam:Hydrolase 571 826 6.5e-8 PFAM
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1148 1171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170324
Predicted Effect probably benign
Transcript: ENSMUST00000170739
SMART Domains Protein: ENSMUSP00000127720
Gene: ENSMUSG00000060671

DomainStartEndE-ValueType
Pfam:Hydrolase_like2 1 82 1.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171818
Predicted Effect unknown
Transcript: ENSMUST00000171941
AA Change: A60P
SMART Domains Protein: ENSMUSP00000130545
Gene: ENSMUSG00000060671
AA Change: A60P

DomainStartEndE-ValueType
Pfam:HAD 2 158 3.3e-8 PFAM
Pfam:Hydrolase_3 124 167 1.7e-6 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bclaf3 T A X: 159,551,832 H41Q probably benign Het
Bsn C A 9: 108,105,739 R3605M unknown Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah11 A G 12: 118,131,341 M718T probably benign Het
Dsg4 A T 18: 20,471,001 T842S probably damaging Het
Epb41l5 T C 1: 119,605,243 Q388R probably benign Het
Fbxo6 A G 4: 148,149,633 probably benign Het
Frem1 A C 4: 83,011,867 Y281D probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Gtpbp2 A G 17: 46,165,882 T329A probably benign Het
Hemgn T C 4: 46,396,421 T272A possibly damaging Het
Hinfp A G 9: 44,302,515 C22R probably damaging Het
Hoxc13 G A 15: 102,921,438 G84D possibly damaging Het
Ing5 T A 1: 93,812,676 S106R probably damaging Het
Mbd6 G A 10: 127,284,943 probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Olfr1113 A G 2: 87,212,996 I35V probably benign Het
Olfr1459 A G 19: 13,145,894 F255S probably damaging Het
Olfr843 A G 9: 19,248,683 S239P possibly damaging Het
Olfr859 A T 9: 19,808,899 I194F probably benign Het
Pde4d T G 13: 109,740,479 V53G probably benign Het
Shisa9 G A 16: 12,267,664 R379Q probably damaging Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tiam2 A G 17: 3,414,113 D39G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Zfp386 T A 12: 116,059,550 L296* probably null Het
Zfp605 G T 5: 110,128,698 G561W probably damaging Het
Other mutations in Atp8b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Atp8b2 APN 3 89949853 missense probably damaging 1.00
IGL02472:Atp8b2 APN 3 89954239 missense probably damaging 1.00
IGL02651:Atp8b2 APN 3 89954589 unclassified probably null
IGL03057:Atp8b2 APN 3 89944186 missense probably damaging 1.00
IGL03349:Atp8b2 APN 3 89957817 missense probably damaging 1.00
IGL03382:Atp8b2 APN 3 89948521 missense probably benign 0.00
R0550:Atp8b2 UTSW 3 89959061 splice site probably benign
R0784:Atp8b2 UTSW 3 89957073 missense probably damaging 0.99
R1249:Atp8b2 UTSW 3 89947804 missense possibly damaging 0.77
R1447:Atp8b2 UTSW 3 89944170 missense probably damaging 1.00
R1568:Atp8b2 UTSW 3 89949848 missense probably damaging 0.98
R1647:Atp8b2 UTSW 3 89941784 missense probably benign 0.30
R1736:Atp8b2 UTSW 3 89952694 missense probably damaging 0.98
R1907:Atp8b2 UTSW 3 89946276 missense probably benign 0.28
R2656:Atp8b2 UTSW 3 89941758 missense probably benign 0.05
R2888:Atp8b2 UTSW 3 89958293 missense probably damaging 1.00
R3706:Atp8b2 UTSW 3 89945152 missense probably damaging 0.99
R3708:Atp8b2 UTSW 3 89945152 missense probably damaging 0.99
R3740:Atp8b2 UTSW 3 89946031 missense probably benign
R3741:Atp8b2 UTSW 3 89946031 missense probably benign
R3896:Atp8b2 UTSW 3 89957319 missense probably damaging 1.00
R3914:Atp8b2 UTSW 3 89954448 missense probably damaging 0.98
R4536:Atp8b2 UTSW 3 89941784 missense probably benign 0.30
R4770:Atp8b2 UTSW 3 89957067 missense probably damaging 0.97
R4859:Atp8b2 UTSW 3 89945980 missense probably benign
R4905:Atp8b2 UTSW 3 89949008 missense probably benign
R4925:Atp8b2 UTSW 3 89946623 critical splice donor site probably null
R4955:Atp8b2 UTSW 3 89952920 unclassified probably benign
R5433:Atp8b2 UTSW 3 89952909 unclassified probably benign
R5458:Atp8b2 UTSW 3 89946022 missense probably benign 0.00
R5517:Atp8b2 UTSW 3 89946031 missense probably benign
R5663:Atp8b2 UTSW 3 89941794 missense probably benign 0.19
R6056:Atp8b2 UTSW 3 89946221 missense possibly damaging 0.79
R6821:Atp8b2 UTSW 3 89948173 missense probably damaging 0.99
R7069:Atp8b2 UTSW 3 89954571 missense probably damaging 1.00
R7178:Atp8b2 UTSW 3 89943672 missense possibly damaging 0.88
R7533:Atp8b2 UTSW 3 89945524 missense
R7552:Atp8b2 UTSW 3 89946764 missense probably damaging 1.00
Z1088:Atp8b2 UTSW 3 89954568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTCTGAGCACTGTCCTG -3'
(R):5'- TCCTGTAAGATGCTGACTGAC -3'

Sequencing Primer
(F):5'- AGCACTGTCCTGCCTGGTAG -3'
(R):5'- GTTTGTAGTCACAGGCCACACTG -3'
Posted On2015-03-18