Incidental Mutation 'R3742:Hemgn'
ID270404
Institutional Source Beutler Lab
Gene Symbol Hemgn
Ensembl Gene ENSMUSG00000028332
Gene Namehemogen
Synonyms4921524M03Rik, EDAG
MMRRC Submission 040728-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3742 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location46393989-46413506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46396421 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 272 (T272A)
Ref Sequence ENSEMBL: ENSMUSP00000103393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071096] [ENSMUST00000107764]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071096
AA Change: T272A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066383
Gene: ENSMUSG00000028332
AA Change: T272A

DomainStartEndE-ValueType
low complexity region 66 81 N/A INTRINSIC
internal_repeat_1 160 256 4.18e-7 PROSPERO
low complexity region 314 326 N/A INTRINSIC
internal_repeat_1 346 436 4.18e-7 PROSPERO
low complexity region 444 455 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107764
AA Change: T272A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103393
Gene: ENSMUSG00000028332
AA Change: T272A

DomainStartEndE-ValueType
low complexity region 66 81 N/A INTRINSIC
internal_repeat_1 160 256 4.18e-7 PROSPERO
low complexity region 314 326 N/A INTRINSIC
internal_repeat_1 346 436 4.18e-7 PROSPERO
low complexity region 444 455 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b2 C G 3: 89,946,031 A726P probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bclaf3 T A X: 159,551,832 H41Q probably benign Het
Bsn C A 9: 108,105,739 R3605M unknown Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah11 A G 12: 118,131,341 M718T probably benign Het
Dsg4 A T 18: 20,471,001 T842S probably damaging Het
Epb41l5 T C 1: 119,605,243 Q388R probably benign Het
Fbxo6 A G 4: 148,149,633 probably benign Het
Frem1 A C 4: 83,011,867 Y281D probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Gtpbp2 A G 17: 46,165,882 T329A probably benign Het
Hinfp A G 9: 44,302,515 C22R probably damaging Het
Hoxc13 G A 15: 102,921,438 G84D possibly damaging Het
Ing5 T A 1: 93,812,676 S106R probably damaging Het
Mbd6 G A 10: 127,284,943 probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Olfr1113 A G 2: 87,212,996 I35V probably benign Het
Olfr1459 A G 19: 13,145,894 F255S probably damaging Het
Olfr843 A G 9: 19,248,683 S239P possibly damaging Het
Olfr859 A T 9: 19,808,899 I194F probably benign Het
Pde4d T G 13: 109,740,479 V53G probably benign Het
Shisa9 G A 16: 12,267,664 R379Q probably damaging Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tiam2 A G 17: 3,414,113 D39G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Zfp386 T A 12: 116,059,550 L296* probably null Het
Zfp605 G T 5: 110,128,698 G561W probably damaging Het
Other mutations in Hemgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Hemgn APN 4 46396240 missense probably benign
IGL00846:Hemgn APN 4 46396171 missense possibly damaging 0.91
IGL00930:Hemgn APN 4 46396383 nonsense probably null
IGL01875:Hemgn APN 4 46396994 missense possibly damaging 0.65
IGL01937:Hemgn APN 4 46396057 missense probably damaging 1.00
IGL02217:Hemgn APN 4 46396420 missense probably damaging 0.98
IGL02325:Hemgn APN 4 46396085 missense probably benign 0.05
IGL02746:Hemgn APN 4 46400740 missense probably damaging 0.99
IGL03093:Hemgn APN 4 46396504 missense probably benign 0.26
IGL03240:Hemgn APN 4 46400732 nonsense probably null
PIT4504001:Hemgn UTSW 4 46395863 missense probably benign
R0925:Hemgn UTSW 4 46397049 missense probably damaging 0.98
R1413:Hemgn UTSW 4 46396091 missense possibly damaging 0.94
R1795:Hemgn UTSW 4 46395958 missense probably damaging 0.97
R1844:Hemgn UTSW 4 46396655 missense possibly damaging 0.85
R2152:Hemgn UTSW 4 46396607 nonsense probably null
R2169:Hemgn UTSW 4 46396417 missense possibly damaging 0.92
R2207:Hemgn UTSW 4 46396301 missense possibly damaging 0.66
R4515:Hemgn UTSW 4 46396477 missense probably damaging 0.98
R5310:Hemgn UTSW 4 46403927 missense possibly damaging 0.77
R5445:Hemgn UTSW 4 46400738 missense probably benign 0.09
R5456:Hemgn UTSW 4 46396571 missense probably damaging 0.99
R6520:Hemgn UTSW 4 46396466 missense probably damaging 0.98
R6575:Hemgn UTSW 4 46395990 missense possibly damaging 0.46
R6983:Hemgn UTSW 4 46395997 missense possibly damaging 0.92
R7204:Hemgn UTSW 4 46397054 missense possibly damaging 0.94
R7443:Hemgn UTSW 4 46396145 missense probably damaging 0.96
R7567:Hemgn UTSW 4 46397034 missense probably damaging 0.96
R7623:Hemgn UTSW 4 46396504 missense probably benign 0.07
R8181:Hemgn UTSW 4 46396504 missense possibly damaging 0.52
Z1177:Hemgn UTSW 4 46400693 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTCACAGCCATTCCCAGATC -3'
(R):5'- CACTTGAAGAAATGGCTGCAGC -3'

Sequencing Primer
(F):5'- CCAGATCTGGGTCGGAAGTG -3'
(R):5'- ACTCTCTCCTAAAATGTGCCAGG -3'
Posted On2015-03-18