Incidental Mutation 'R3742:Shisa9'
ID270425
Institutional Source Beutler Lab
Gene Symbol Shisa9
Ensembl Gene ENSMUSG00000022494
Gene Nameshisa family member 9
SynonymsCKAMP44, 2700045P11Rik
MMRRC Submission 040728-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R3742 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location11984113-12270902 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12267664 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 379 (R379Q)
Ref Sequence ENSEMBL: ENSMUSP00000132646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023138] [ENSMUST00000170672]
Predicted Effect probably damaging
Transcript: ENSMUST00000023138
AA Change: R363Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023138
Gene: ENSMUSG00000022494
AA Change: R363Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 28 61 N/A INTRINSIC
Pfam:Shisa 70 254 7.9e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170672
AA Change: R379Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132646
Gene: ENSMUSG00000022494
AA Change: R379Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 28 61 N/A INTRINSIC
Pfam:Shisa 71 260 2.1e-55 PFAM
Meta Mutation Damage Score 0.0903 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced AMPA-mediated synaptic currents in retinogeniculate and corticogeniculate synapses, enhanced paired-pulse facilitation in retinogeniculate synapses and decreased synaptic depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b2 C G 3: 89,946,031 A726P probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bclaf3 T A X: 159,551,832 H41Q probably benign Het
Bsn C A 9: 108,105,739 R3605M unknown Het
Ctso G A 3: 81,952,249 V288I probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah11 A G 12: 118,131,341 M718T probably benign Het
Dsg4 A T 18: 20,471,001 T842S probably damaging Het
Epb41l5 T C 1: 119,605,243 Q388R probably benign Het
Fbxo6 A G 4: 148,149,633 probably benign Het
Frem1 A C 4: 83,011,867 Y281D probably damaging Het
Gm6489 T A 1: 31,287,683 noncoding transcript Het
Gtpbp2 A G 17: 46,165,882 T329A probably benign Het
Hemgn T C 4: 46,396,421 T272A possibly damaging Het
Hinfp A G 9: 44,302,515 C22R probably damaging Het
Hoxc13 G A 15: 102,921,438 G84D possibly damaging Het
Ing5 T A 1: 93,812,676 S106R probably damaging Het
Mbd6 G A 10: 127,284,943 probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup210l A T 3: 90,207,394 M1759L probably benign Het
Olfr1113 A G 2: 87,212,996 I35V probably benign Het
Olfr1459 A G 19: 13,145,894 F255S probably damaging Het
Olfr843 A G 9: 19,248,683 S239P possibly damaging Het
Olfr859 A T 9: 19,808,899 I194F probably benign Het
Pde4d T G 13: 109,740,479 V53G probably benign Het
Syngr4 T C 7: 45,895,770 E5G possibly damaging Het
Tiam2 A G 17: 3,414,113 D39G possibly damaging Het
Tmem88b A G 4: 155,785,427 L59P probably damaging Het
Zfp386 T A 12: 116,059,550 L296* probably null Het
Zfp605 G T 5: 110,128,698 G561W probably damaging Het
Other mutations in Shisa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Shisa9 APN 16 12244658 missense probably benign 0.04
IGL02011:Shisa9 APN 16 12244638 missense possibly damaging 0.87
IGL02884:Shisa9 APN 16 11997043 splice site probably benign
PIT4508001:Shisa9 UTSW 16 12267480 missense probably benign 0.00
R0194:Shisa9 UTSW 16 11984954 missense probably damaging 1.00
R0309:Shisa9 UTSW 16 11997123 missense probably damaging 1.00
R0588:Shisa9 UTSW 16 12267774 missense probably damaging 0.99
R1469:Shisa9 UTSW 16 11985071 missense probably damaging 1.00
R1469:Shisa9 UTSW 16 11985071 missense probably damaging 1.00
R1781:Shisa9 UTSW 16 12267657 missense probably benign 0.00
R1818:Shisa9 UTSW 16 12267562 missense probably damaging 0.96
R1943:Shisa9 UTSW 16 12267756 missense probably benign 0.06
R2263:Shisa9 UTSW 16 11984767 missense possibly damaging 0.53
R5068:Shisa9 UTSW 16 12267548 missense possibly damaging 0.48
R5977:Shisa9 UTSW 16 12267428 missense probably benign 0.01
R6032:Shisa9 UTSW 16 11984908 missense possibly damaging 0.76
R6032:Shisa9 UTSW 16 11984908 missense possibly damaging 0.76
R6487:Shisa9 UTSW 16 12244611 missense probably benign 0.01
R6773:Shisa9 UTSW 16 11985028 missense probably damaging 1.00
R8341:Shisa9 UTSW 16 11997151 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- CAATGATGACTTCTACGCCAAAAG -3'
(R):5'- CAGTTGAGTGTGGTCTCCAG -3'

Sequencing Primer
(F):5'- TGGCTGTCAAGGGAAATCTCC -3'
(R):5'- TGGTCTCCAGGGTGCTC -3'
Posted On2015-03-18