Incidental Mutation 'R3743:Zc3h6'
ID270435
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Namezinc finger CCCH type containing 6
Synonyms
MMRRC Submission 040729-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R3743 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location128967402-129018563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128997792 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 175 (Y175C)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110319] [ENSMUST00000110320]
Predicted Effect probably benign
Transcript: ENSMUST00000110319
SMART Domains Protein: ENSMUSP00000105948
Gene: ENSMUSG00000042851

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110320
AA Change: Y175C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: Y175C

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Meta Mutation Damage Score 0.3728 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A G 4: 137,455,037 R168G probably damaging Het
1700030K09Rik A G 8: 72,445,169 H140R probably benign Het
Adamts10 A G 17: 33,528,712 I41V probably damaging Het
Arnt T C 3: 95,474,705 V198A possibly damaging Het
Atg3 A G 16: 45,178,228 probably null Het
Atmin T C 8: 116,956,573 V324A probably benign Het
Ccdc88c G A 12: 100,948,584 R464C probably damaging Het
Ccr7 G T 11: 99,145,207 S296R possibly damaging Het
Cdh12 T A 15: 21,537,659 S415R probably damaging Het
Cep162 A T 9: 87,217,177 probably benign Het
Chd3 G A 11: 69,364,050 R61* probably null Het
Cr2 A G 1: 195,149,966 probably benign Het
Csf1r T C 18: 61,114,774 S305P probably benign Het
Cyp4a31 A C 4: 115,566,519 Q140P possibly damaging Het
Dhx40 A T 11: 86,771,159 W691R probably damaging Het
Dlgap1 G A 17: 70,718,226 probably null Het
Exoc5 A T 14: 49,033,407 L387* probably null Het
Exoc5 T C 14: 49,014,349 I582V probably benign Het
Fbxw8 A G 5: 118,113,639 S270P probably damaging Het
Fgf14 C A 14: 124,676,620 G33V probably benign Het
Hoxd9 T A 2: 74,698,366 V104E probably damaging Het
Igsf10 T C 3: 59,326,125 H1729R possibly damaging Het
Irf8 C T 8: 120,753,571 R274C probably damaging Het
Itgb4 G A 11: 116,003,670 M1350I probably damaging Het
Lrrn4 A G 2: 132,869,866 probably null Het
Map3k6 C T 4: 133,245,073 T320I probably benign Het
Morc2a A G 11: 3,683,700 E604G possibly damaging Het
Mtmr6 T C 14: 60,300,298 I582T probably benign Het
Ninl A G 2: 150,950,248 V785A probably benign Het
Obscn T C 11: 59,079,085 E77G probably damaging Het
Olfr1314 A G 2: 112,092,620 L27P probably benign Het
Olfr134 T G 17: 38,175,902 F273V probably damaging Het
Olfr222 T C 11: 59,571,509 Y77C probably damaging Het
Pcdhb2 A G 18: 37,296,417 D124G probably damaging Het
Pfkl G A 10: 77,996,345 T304M probably damaging Het
Ppil4 T A 10: 7,821,171 S483T unknown Het
Sdccag3 A G 2: 26,388,643 probably benign Het
Slc7a10 C T 7: 35,198,900 T332I probably damaging Het
Spats2 T C 15: 99,210,914 S382P probably benign Het
Stpg1 T A 4: 135,514,886 D70E probably benign Het
Tmprss11e G A 5: 86,709,456 Q333* probably null Het
Trpv1 A T 11: 73,254,302 D430V probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 129011875 missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 129017378 missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128997685 missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128993226 missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 129016581 missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 129015611 missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128997795 missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 129015412 missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 129014827 missense probably benign 0.00
R0538:Zc3h6 UTSW 2 129017223 missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 129006816 missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 129017136 missense probably benign 0.00
R1528:Zc3h6 UTSW 2 129017069 missense probably benign 0.01
R1698:Zc3h6 UTSW 2 129017358 missense probably benign
R1712:Zc3h6 UTSW 2 129016734 missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 129016620 missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128997795 missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 129006086 missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 129015618 missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128967830 missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 129014709 missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128993202 missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 129015460 missense probably benign 0.43
R2899:Zc3h6 UTSW 2 129002232 missense probably benign 0.00
R3711:Zc3h6 UTSW 2 129017331 missense probably benign 0.00
R3893:Zc3h6 UTSW 2 129016140 missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 129002240 missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 129010433 missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 129017309 missense probably benign 0.00
R5125:Zc3h6 UTSW 2 129014479 missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128993452 intron probably benign
R5802:Zc3h6 UTSW 2 129015559 missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128993277 missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128997776 splice site probably null
R5950:Zc3h6 UTSW 2 128997790 nonsense probably null
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 129015421 missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128993411 missense unknown
R7340:Zc3h6 UTSW 2 128993190 missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 129017252 missense probably benign 0.02
R7576:Zc3h6 UTSW 2 129014553 missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 129015635 critical splice donor site probably null
R7924:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 129017014 missense probably benign 0.30
R8877:Zc3h6 UTSW 2 129014399 nonsense probably null
Z1176:Zc3h6 UTSW 2 129016221 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACGTATATCAGGAAGTTACATGAC -3'
(R):5'- TAGGCTCAAGGTCTACACGG -3'

Sequencing Primer
(F):5'- ATCAGGAAGTTACATGACATCAAAG -3'
(R):5'- GCTCAAGGTCTACACGGTACAG -3'
Posted On2015-03-18