Incidental Mutation 'R3743:Ninl'
ID270437
Institutional Source Beutler Lab
Gene Symbol Ninl
Ensembl Gene ENSMUSG00000068115
Gene Nameninein-like
SynonymsLOC381387, LOC381388, 4930519N13Rik
MMRRC Submission 040729-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3743 (G1)
Quality Score137
Status Validated
Chromosome2
Chromosomal Location150934519-151039382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150950248 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 785 (V785A)
Ref Sequence ENSEMBL: ENSMUSP00000105522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109896] [ENSMUST00000124135]
Predicted Effect probably benign
Transcript: ENSMUST00000109896
AA Change: V785A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000105522
Gene: ENSMUSG00000068115
AA Change: V785A

DomainStartEndE-ValueType
EFh 12 40 6.56e0 SMART
low complexity region 76 93 N/A INTRINSIC
EFh 201 229 4.45e1 SMART
EFh 238 266 8.98e-4 SMART
low complexity region 295 306 N/A INTRINSIC
coiled coil region 381 423 N/A INTRINSIC
coiled coil region 461 517 N/A INTRINSIC
coiled coil region 541 584 N/A INTRINSIC
coiled coil region 620 699 N/A INTRINSIC
coiled coil region 728 751 N/A INTRINSIC
coiled coil region 835 863 N/A INTRINSIC
coiled coil region 1058 1334 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117833
Predicted Effect probably benign
Transcript: ENSMUST00000124135
SMART Domains Protein: ENSMUSP00000122069
Gene: ENSMUSG00000068115

DomainStartEndE-ValueType
coiled coil region 16 61 N/A INTRINSIC
coiled coil region 92 266 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147293
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit bone-marrow myeloid hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A G 4: 137,455,037 R168G probably damaging Het
1700030K09Rik A G 8: 72,445,169 H140R probably benign Het
Adamts10 A G 17: 33,528,712 I41V probably damaging Het
Arnt T C 3: 95,474,705 V198A possibly damaging Het
Atg3 A G 16: 45,178,228 probably null Het
Atmin T C 8: 116,956,573 V324A probably benign Het
Ccdc88c G A 12: 100,948,584 R464C probably damaging Het
Ccr7 G T 11: 99,145,207 S296R possibly damaging Het
Cdh12 T A 15: 21,537,659 S415R probably damaging Het
Cep162 A T 9: 87,217,177 probably benign Het
Chd3 G A 11: 69,364,050 R61* probably null Het
Cr2 A G 1: 195,149,966 probably benign Het
Csf1r T C 18: 61,114,774 S305P probably benign Het
Cyp4a31 A C 4: 115,566,519 Q140P possibly damaging Het
Dhx40 A T 11: 86,771,159 W691R probably damaging Het
Dlgap1 G A 17: 70,718,226 probably null Het
Exoc5 T C 14: 49,014,349 I582V probably benign Het
Exoc5 A T 14: 49,033,407 L387* probably null Het
Fbxw8 A G 5: 118,113,639 S270P probably damaging Het
Fgf14 C A 14: 124,676,620 G33V probably benign Het
Hoxd9 T A 2: 74,698,366 V104E probably damaging Het
Igsf10 T C 3: 59,326,125 H1729R possibly damaging Het
Irf8 C T 8: 120,753,571 R274C probably damaging Het
Itgb4 G A 11: 116,003,670 M1350I probably damaging Het
Lrrn4 A G 2: 132,869,866 probably null Het
Map3k6 C T 4: 133,245,073 T320I probably benign Het
Morc2a A G 11: 3,683,700 E604G possibly damaging Het
Mtmr6 T C 14: 60,300,298 I582T probably benign Het
Obscn T C 11: 59,079,085 E77G probably damaging Het
Olfr1314 A G 2: 112,092,620 L27P probably benign Het
Olfr134 T G 17: 38,175,902 F273V probably damaging Het
Olfr222 T C 11: 59,571,509 Y77C probably damaging Het
Pcdhb2 A G 18: 37,296,417 D124G probably damaging Het
Pfkl G A 10: 77,996,345 T304M probably damaging Het
Ppil4 T A 10: 7,821,171 S483T unknown Het
Sdccag3 A G 2: 26,388,643 probably benign Het
Slc7a10 C T 7: 35,198,900 T332I probably damaging Het
Spats2 T C 15: 99,210,914 S382P probably benign Het
Stpg1 T A 4: 135,514,886 D70E probably benign Het
Tmprss11e G A 5: 86,709,456 Q333* probably null Het
Trpv1 A T 11: 73,254,302 D430V probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zc3h6 A G 2: 128,997,792 Y175C probably damaging Het
Other mutations in Ninl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ninl APN 2 150966241 missense probably damaging 0.98
IGL01697:Ninl APN 2 150939947 missense probably damaging 1.00
IGL01756:Ninl APN 2 150979516 missense probably damaging 1.00
IGL01925:Ninl APN 2 150971059 missense probably damaging 1.00
IGL02341:Ninl APN 2 150944605 nonsense probably null
IGL02838:Ninl APN 2 150955711 splice site probably null
IGL02868:Ninl APN 2 150937054 missense probably benign
IGL03116:Ninl APN 2 150964219 missense probably damaging 1.00
IGL03396:Ninl APN 2 150966212 missense possibly damaging 0.88
R0117:Ninl UTSW 2 150937673 missense probably damaging 0.98
R0685:Ninl UTSW 2 150939855 missense possibly damaging 0.73
R0928:Ninl UTSW 2 150963475 missense probably damaging 0.99
R1051:Ninl UTSW 2 150970126 missense probably damaging 1.00
R1441:Ninl UTSW 2 150971124 missense probably benign 0.10
R1493:Ninl UTSW 2 150980095 missense probably damaging 1.00
R1499:Ninl UTSW 2 150980176 missense possibly damaging 0.70
R1539:Ninl UTSW 2 150975947 missense probably damaging 1.00
R1658:Ninl UTSW 2 150964159 missense probably damaging 1.00
R2038:Ninl UTSW 2 150975843 nonsense probably null
R2156:Ninl UTSW 2 150944583 missense probably damaging 1.00
R2232:Ninl UTSW 2 150950050 missense probably benign 0.00
R2373:Ninl UTSW 2 150980117 missense probably damaging 1.00
R3906:Ninl UTSW 2 150980119 missense probably damaging 1.00
R3950:Ninl UTSW 2 150952488 missense possibly damaging 0.90
R4283:Ninl UTSW 2 150953416 unclassified probably benign
R4798:Ninl UTSW 2 150959881 nonsense probably null
R4963:Ninl UTSW 2 150939909 missense probably benign 0.04
R4998:Ninl UTSW 2 150953364 missense probably damaging 1.00
R5343:Ninl UTSW 2 150971190 missense probably benign 0.01
R5810:Ninl UTSW 2 150950168 missense probably benign 0.31
R5825:Ninl UTSW 2 150940724 missense probably damaging 1.00
R6436:Ninl UTSW 2 150966178 missense probably damaging 1.00
R6728:Ninl UTSW 2 150975857 nonsense probably null
R6734:Ninl UTSW 2 150945083 critical splice donor site probably null
R6997:Ninl UTSW 2 150966225 missense probably benign 0.08
R7135:Ninl UTSW 2 150955604 missense probably benign 0.00
R7157:Ninl UTSW 2 150949343 missense possibly damaging 0.63
R7315:Ninl UTSW 2 150950050 missense probably benign 0.00
R7840:Ninl UTSW 2 150966096 missense probably benign 0.00
R7923:Ninl UTSW 2 150966096 missense probably benign 0.00
X0062:Ninl UTSW 2 150970046 missense probably damaging 1.00
Z1177:Ninl UTSW 2 150953398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCTTCAGGAGAGCACGCAG -3'
(R):5'- TGCTAGCAGAACCCAAAGCG -3'

Sequencing Primer
(F):5'- CATCTGCCTCCTGGACAAG -3'
(R):5'- AAAGCGTACACCTGTGTTTCTG -3'
Posted On2015-03-18