Mutagenetix > Incidental Mutation

Incidental Mutation 'R3743:Map3k6'

270442

Institutional Source

Beutler Lab

Gene Symbol

Map3k6

Ensembl Gene

ENSMUSG00000028862

Gene Name

mitogen-activated protein kinase kinase kinase 6

Synonyms

Ask2, MAPKKK6, MEKK6

MMRRC Submission

040729-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.346) question?

Stock #

R3743 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

133240818-133252929 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 133245073 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 320 (T320I)

Ref Sequence

ENSEMBL: ENSMUSP00000030677 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030677]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000030677
AA Change: T320I

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862
AA Change: T320I

Domain	Start	End	E-Value	Type
low complexity region	98	109	N/A	INTRINSIC
Pfam:DUF4071	130	508	2.3e-150	PFAM
S_TKc	649	907	3.49e-87	SMART
low complexity region	925	940	N/A	INTRINSIC
low complexity region	947	960	N/A	INTRINSIC
low complexity region	975	990	N/A	INTRINSIC
low complexity region	1130	1146	N/A	INTRINSIC
coiled coil region	1164	1195	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123612

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127681

Meta Mutation Damage Score

0.1283

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that forms a component of protein kinase-mediated signal transduction cascades. The encoded kinase participates in the regulation of vascular endothelial growth factor (VEGF) expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous and heterozygous null mice display an increased incidence of chemically induced skin tumors and homozygous mice also show resistance to induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	A	G	4: 137,455,037	R168G	probably damaging	Het
1700030K09Rik	A	G	8: 72,445,169	H140R	probably benign	Het
Adamts10	A	G	17: 33,528,712	I41V	probably damaging	Het
Arnt	T	C	3: 95,474,705	V198A	possibly damaging	Het
Atg3	A	G	16: 45,178,228		probably null	Het
Atmin	T	C	8: 116,956,573	V324A	probably benign	Het
Ccdc88c	G	A	12: 100,948,584	R464C	probably damaging	Het
Ccr7	G	T	11: 99,145,207	S296R	possibly damaging	Het
Cdh12	T	A	15: 21,537,659	S415R	probably damaging	Het
Cep162	A	T	9: 87,217,177		probably benign	Het
Chd3	G	A	11: 69,364,050	R61*	probably null	Het
Cr2	A	G	1: 195,149,966		probably benign	Het
Csf1r	T	C	18: 61,114,774	S305P	probably benign	Het
Cyp4a31	A	C	4: 115,566,519	Q140P	possibly damaging	Het
Dhx40	A	T	11: 86,771,159	W691R	probably damaging	Het
Dlgap1	G	A	17: 70,718,226		probably null	Het
Exoc5	T	C	14: 49,014,349	I582V	probably benign	Het
Exoc5	A	T	14: 49,033,407	L387*	probably null	Het
Fbxw8	A	G	5: 118,113,639	S270P	probably damaging	Het
Fgf14	C	A	14: 124,676,620	G33V	probably benign	Het
Hoxd9	T	A	2: 74,698,366	V104E	probably damaging	Het
Igsf10	T	C	3: 59,326,125	H1729R	possibly damaging	Het
Irf8	C	T	8: 120,753,571	R274C	probably damaging	Het
Itgb4	G	A	11: 116,003,670	M1350I	probably damaging	Het
Lrrn4	A	G	2: 132,869,866		probably null	Het
Morc2a	A	G	11: 3,683,700	E604G	possibly damaging	Het
Mtmr6	T	C	14: 60,300,298	I582T	probably benign	Het
Ninl	A	G	2: 150,950,248	V785A	probably benign	Het
Obscn	T	C	11: 59,079,085	E77G	probably damaging	Het
Olfr1314	A	G	2: 112,092,620	L27P	probably benign	Het
Olfr134	T	G	17: 38,175,902	F273V	probably damaging	Het
Olfr222	T	C	11: 59,571,509	Y77C	probably damaging	Het
Pcdhb2	A	G	18: 37,296,417	D124G	probably damaging	Het
Pfkl	G	A	10: 77,996,345	T304M	probably damaging	Het
Ppil4	T	A	10: 7,821,171	S483T	unknown	Het
Sdccag3	A	G	2: 26,388,643		probably benign	Het
Slc7a10	C	T	7: 35,198,900	T332I	probably damaging	Het
Spats2	T	C	15: 99,210,914	S382P	probably benign	Het
Stpg1	T	A	4: 135,514,886	D70E	probably benign	Het
Tmprss11e	G	A	5: 86,709,456	Q333*	probably null	Het
Trpv1	A	T	11: 73,254,302	D430V	probably damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Zc3h6	A	G	2: 128,997,792	Y175C	probably damaging	Het

Other mutations in Map3k6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Map3k6	APN	4	133243044	splice site	probably benign
IGL01060:Map3k6	APN	4	133247302	splice site	probably null
IGL01116:Map3k6	APN	4	133247128	missense	probably damaging	0.98
IGL01341:Map3k6	APN	4	133248060	missense	possibly damaging	0.67
IGL02383:Map3k6	APN	4	133246621	splice site	probably null
IGL03090:Map3k6	APN	4	133243366	missense	probably benign	0.05
IGL03096:Map3k6	APN	4	133251345	nonsense	probably null
IGL03149:Map3k6	APN	4	133249688	missense	probably damaging	1.00
R0110:Map3k6	UTSW	4	133243794	missense	probably damaging	1.00
R0142:Map3k6	UTSW	4	133250946	missense	probably benign
R0189:Map3k6	UTSW	4	133246941	missense	possibly damaging	0.46
R0368:Map3k6	UTSW	4	133252659	missense	probably benign	0.23
R0417:Map3k6	UTSW	4	133248082	nonsense	probably null
R0595:Map3k6	UTSW	4	133241263	missense	probably damaging	0.98
R0597:Map3k6	UTSW	4	133245552	missense	possibly damaging	0.46
R0699:Map3k6	UTSW	4	133248126	missense	probably damaging	1.00
R1099:Map3k6	UTSW	4	133247128	missense	probably damaging	1.00
R1113:Map3k6	UTSW	4	133245815	missense	probably damaging	1.00
R1308:Map3k6	UTSW	4	133245815	missense	probably damaging	1.00
R1607:Map3k6	UTSW	4	133252473	missense	probably damaging	1.00
R2217:Map3k6	UTSW	4	133246672	missense	possibly damaging	0.46
R3734:Map3k6	UTSW	4	133248396	missense	possibly damaging	0.79
R3735:Map3k6	UTSW	4	133246372	missense	probably benign	0.21
R4244:Map3k6	UTSW	4	133251947	missense	possibly damaging	0.65
R4245:Map3k6	UTSW	4	133251947	missense	possibly damaging	0.65
R4465:Map3k6	UTSW	4	133246333	missense	possibly damaging	0.66
R4482:Map3k6	UTSW	4	133243399	missense	probably benign	0.00
R4827:Map3k6	UTSW	4	133248849	missense	possibly damaging	0.92
R5092:Map3k6	UTSW	4	133251743	missense	probably benign	0.00
R5110:Map3k6	UTSW	4	133247548	intron	probably benign
R5258:Map3k6	UTSW	4	133247642	missense	possibly damaging	0.81
R5369:Map3k6	UTSW	4	133247681	missense	probably damaging	0.99
R5642:Map3k6	UTSW	4	133245544	missense	probably damaging	0.99
R5648:Map3k6	UTSW	4	133243335	missense	probably benign	0.25
R6102:Map3k6	UTSW	4	133247131	critical splice donor site	probably null
R6144:Map3k6	UTSW	4	133245675	missense	probably damaging	1.00
R6476:Map3k6	UTSW	4	133250086	missense	probably damaging	0.98
R6511:Map3k6	UTSW	4	133248078	missense	probably damaging	0.98
R6522:Map3k6	UTSW	4	133250024	missense	possibly damaging	0.65
R6706:Map3k6	UTSW	4	133250939	nonsense	probably null
R6874:Map3k6	UTSW	4	133250656	missense	probably benign	0.02
R7069:Map3k6	UTSW	4	133251712	missense	probably benign	0.01
R7216:Map3k6	UTSW	4	133246900	missense	probably damaging	0.99
R7417:Map3k6	UTSW	4	133248396	missense	probably benign	0.43
R7538:Map3k6	UTSW	4	133251927	missense	probably benign
R7569:Map3k6	UTSW	4	133250077	missense	probably benign	0.04
R8003:Map3k6	UTSW	4	133248882	missense	probably benign	0.05
R8407:Map3k6	UTSW	4	133247593	missense	possibly damaging	0.95
R8817:Map3k6	UTSW	4	133246760	missense	probably benign	0.00
R8939:Map3k6	UTSW	4	133252643	unclassified	probably benign
R9285:Map3k6	UTSW	4	133245559	missense	probably damaging	1.00
R9308:Map3k6	UTSW	4	133243411	missense	probably damaging	1.00
R9400:Map3k6	UTSW	4	133241156	missense	probably damaging	1.00
R9401:Map3k6	UTSW	4	133241156	missense	probably damaging	1.00
R9573:Map3k6	UTSW	4	133252463	missense	probably damaging	0.99
R9677:Map3k6	UTSW	4	133241116	missense	probably benign	0.04
R9682:Map3k6	UTSW	4	133248108	missense	possibly damaging	0.61
R9745:Map3k6	UTSW	4	133252472	missense	probably damaging	1.00
R9751:Map3k6	UTSW	4	133251857	critical splice acceptor site	probably null
Z1088:Map3k6	UTSW	4	133245066	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGAGGTGTGCAAAGTCTTCAG -3'
(R):5'- ATGCATCCTTAGCCCAGACC -3'

Sequencing Primer
(F):5'- GGGCTATGTAGAGAAACCTCATCTC -3'
(R):5'- CCAACAGGAACCTTGTGACATTAGG -3'

Posted On

2015-03-18