Incidental Mutation 'R3743:1700013G24Rik'
ID270444
Institutional Source Beutler Lab
Gene Symbol 1700013G24Rik
Ensembl Gene ENSMUSG00000041399
Gene NameRIKEN cDNA 1700013G24 gene
Synonyms
MMRRC Submission 040729-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3743 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location137453284-137455461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137455037 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 168 (R168G)
Ref Sequence ENSEMBL: ENSMUSP00000043461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048893]
Predicted Effect probably damaging
Transcript: ENSMUST00000048893
AA Change: R168G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043461
Gene: ENSMUSG00000041399
AA Change: R168G

DomainStartEndE-ValueType
low complexity region 44 65 N/A INTRINSIC
low complexity region 181 203 N/A INTRINSIC
SCOP:d1i50b_ 216 261 3e-3 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,445,169 H140R probably benign Het
Adamts10 A G 17: 33,528,712 I41V probably damaging Het
Arnt T C 3: 95,474,705 V198A possibly damaging Het
Atg3 A G 16: 45,178,228 probably null Het
Atmin T C 8: 116,956,573 V324A probably benign Het
Ccdc88c G A 12: 100,948,584 R464C probably damaging Het
Ccr7 G T 11: 99,145,207 S296R possibly damaging Het
Cdh12 T A 15: 21,537,659 S415R probably damaging Het
Cep162 A T 9: 87,217,177 probably benign Het
Chd3 G A 11: 69,364,050 R61* probably null Het
Cr2 A G 1: 195,149,966 probably benign Het
Csf1r T C 18: 61,114,774 S305P probably benign Het
Cyp4a31 A C 4: 115,566,519 Q140P possibly damaging Het
Dhx40 A T 11: 86,771,159 W691R probably damaging Het
Dlgap1 G A 17: 70,718,226 probably null Het
Exoc5 T C 14: 49,014,349 I582V probably benign Het
Exoc5 A T 14: 49,033,407 L387* probably null Het
Fbxw8 A G 5: 118,113,639 S270P probably damaging Het
Fgf14 C A 14: 124,676,620 G33V probably benign Het
Hoxd9 T A 2: 74,698,366 V104E probably damaging Het
Igsf10 T C 3: 59,326,125 H1729R possibly damaging Het
Irf8 C T 8: 120,753,571 R274C probably damaging Het
Itgb4 G A 11: 116,003,670 M1350I probably damaging Het
Lrrn4 A G 2: 132,869,866 probably null Het
Map3k6 C T 4: 133,245,073 T320I probably benign Het
Morc2a A G 11: 3,683,700 E604G possibly damaging Het
Mtmr6 T C 14: 60,300,298 I582T probably benign Het
Ninl A G 2: 150,950,248 V785A probably benign Het
Obscn T C 11: 59,079,085 E77G probably damaging Het
Olfr1314 A G 2: 112,092,620 L27P probably benign Het
Olfr134 T G 17: 38,175,902 F273V probably damaging Het
Olfr222 T C 11: 59,571,509 Y77C probably damaging Het
Pcdhb2 A G 18: 37,296,417 D124G probably damaging Het
Pfkl G A 10: 77,996,345 T304M probably damaging Het
Ppil4 T A 10: 7,821,171 S483T unknown Het
Sdccag3 A G 2: 26,388,643 probably benign Het
Slc7a10 C T 7: 35,198,900 T332I probably damaging Het
Spats2 T C 15: 99,210,914 S382P probably benign Het
Stpg1 T A 4: 135,514,886 D70E probably benign Het
Tmprss11e G A 5: 86,709,456 Q333* probably null Het
Trpv1 A T 11: 73,254,302 D430V probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zc3h6 A G 2: 128,997,792 Y175C probably damaging Het
Other mutations in 1700013G24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:1700013G24Rik APN 4 137455262 missense possibly damaging 0.82
IGL02646:1700013G24Rik APN 4 137454790 nonsense probably null
R0526:1700013G24Rik UTSW 4 137455224 missense possibly damaging 0.92
R1449:1700013G24Rik UTSW 4 137455355 missense possibly damaging 0.94
R5357:1700013G24Rik UTSW 4 137455152 missense possibly damaging 0.90
R6265:1700013G24Rik UTSW 4 137454675 missense probably damaging 1.00
R6586:1700013G24Rik UTSW 4 137455328 missense possibly damaging 0.90
R6720:1700013G24Rik UTSW 4 137454686 missense possibly damaging 0.94
R6988:1700013G24Rik UTSW 4 137454579 missense probably damaging 1.00
R7640:1700013G24Rik UTSW 4 137454594 missense probably damaging 0.99
R7825:1700013G24Rik UTSW 4 137455343 missense probably damaging 1.00
Z1176:1700013G24Rik UTSW 4 137454992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGAGACGAGTCACCTGAC -3'
(R):5'- TTCAAACCAGTGGAACCCAGG -3'

Sequencing Primer
(F):5'- GTGGTCAAAAAGCCCACCTGTC -3'
(R):5'- AGGCACTGCAGGCTCTTG -3'
Posted On2015-03-18