Incidental Mutation 'R3743:Morc2a'
ID270456
Institutional Source Beutler Lab
Gene Symbol Morc2a
Ensembl Gene ENSMUSG00000034543
Gene Namemicrorchidia 2A
SynonymsZcwcc1, 8430403M08Rik
MMRRC Submission 040729-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3743 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location3649494-3690477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3683700 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 604 (E604G)
Ref Sequence ENSEMBL: ENSMUSP00000094176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093389] [ENSMUST00000096441]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093389
AA Change: E604G

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091087
Gene: ENSMUSG00000034543
AA Change: E604G

DomainStartEndE-ValueType
HATPase_c 24 134 5.35e0 SMART
coiled coil region 285 322 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Pfam:zf-CW 495 542 5.1e-18 PFAM
coiled coil region 555 583 N/A INTRINSIC
low complexity region 600 618 N/A INTRINSIC
low complexity region 678 704 N/A INTRINSIC
low complexity region 714 729 N/A INTRINSIC
coiled coil region 742 776 N/A INTRINSIC
coiled coil region 966 1011 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000096441
AA Change: E604G

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000094176
Gene: ENSMUSG00000034543
AA Change: E604G

DomainStartEndE-ValueType
HATPase_c 24 134 5.35e0 SMART
coiled coil region 285 322 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Pfam:zf-CW 494 543 1.7e-19 PFAM
coiled coil region 555 583 N/A INTRINSIC
low complexity region 600 618 N/A INTRINSIC
low complexity region 678 704 N/A INTRINSIC
low complexity region 714 729 N/A INTRINSIC
coiled coil region 742 776 N/A INTRINSIC
coiled coil region 966 1011 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131517
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Microrchidia (MORC) protein superfamily. The encoded protein is known to regulate the condensation of heterochromatin in response to DNA damage and play a role in repressing transcription. The protein has been found to regulate the activity of ATP citrate lyase via specific interaction with this enzyme in the cytosol of lipogenic breast cancer cells. The protein also plays a role in lipogenesis and adipocyte differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A G 4: 137,455,037 R168G probably damaging Het
1700030K09Rik A G 8: 72,445,169 H140R probably benign Het
Adamts10 A G 17: 33,528,712 I41V probably damaging Het
Arnt T C 3: 95,474,705 V198A possibly damaging Het
Atg3 A G 16: 45,178,228 probably null Het
Atmin T C 8: 116,956,573 V324A probably benign Het
Ccdc88c G A 12: 100,948,584 R464C probably damaging Het
Ccr7 G T 11: 99,145,207 S296R possibly damaging Het
Cdh12 T A 15: 21,537,659 S415R probably damaging Het
Cep162 A T 9: 87,217,177 probably benign Het
Chd3 G A 11: 69,364,050 R61* probably null Het
Cr2 A G 1: 195,149,966 probably benign Het
Csf1r T C 18: 61,114,774 S305P probably benign Het
Cyp4a31 A C 4: 115,566,519 Q140P possibly damaging Het
Dhx40 A T 11: 86,771,159 W691R probably damaging Het
Dlgap1 G A 17: 70,718,226 probably null Het
Exoc5 T C 14: 49,014,349 I582V probably benign Het
Exoc5 A T 14: 49,033,407 L387* probably null Het
Fbxw8 A G 5: 118,113,639 S270P probably damaging Het
Fgf14 C A 14: 124,676,620 G33V probably benign Het
Hoxd9 T A 2: 74,698,366 V104E probably damaging Het
Igsf10 T C 3: 59,326,125 H1729R possibly damaging Het
Irf8 C T 8: 120,753,571 R274C probably damaging Het
Itgb4 G A 11: 116,003,670 M1350I probably damaging Het
Lrrn4 A G 2: 132,869,866 probably null Het
Map3k6 C T 4: 133,245,073 T320I probably benign Het
Mtmr6 T C 14: 60,300,298 I582T probably benign Het
Ninl A G 2: 150,950,248 V785A probably benign Het
Obscn T C 11: 59,079,085 E77G probably damaging Het
Olfr1314 A G 2: 112,092,620 L27P probably benign Het
Olfr134 T G 17: 38,175,902 F273V probably damaging Het
Olfr222 T C 11: 59,571,509 Y77C probably damaging Het
Pcdhb2 A G 18: 37,296,417 D124G probably damaging Het
Pfkl G A 10: 77,996,345 T304M probably damaging Het
Ppil4 T A 10: 7,821,171 S483T unknown Het
Sdccag3 A G 2: 26,388,643 probably benign Het
Slc7a10 C T 7: 35,198,900 T332I probably damaging Het
Spats2 T C 15: 99,210,914 S382P probably benign Het
Stpg1 T A 4: 135,514,886 D70E probably benign Het
Tmprss11e G A 5: 86,709,456 Q333* probably null Het
Trpv1 A T 11: 73,254,302 D430V probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zc3h6 A G 2: 128,997,792 Y175C probably damaging Het
Other mutations in Morc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Morc2a APN 11 3680283 missense probably damaging 0.99
IGL00914:Morc2a APN 11 3668844 splice site probably null
IGL01081:Morc2a APN 11 3688149 missense probably damaging 1.00
IGL01092:Morc2a APN 11 3684042 missense probably benign 0.00
IGL01292:Morc2a APN 11 3688175 missense probably damaging 1.00
IGL01326:Morc2a APN 11 3681775 missense probably benign 0.03
IGL01526:Morc2a APN 11 3650428 missense probably benign 0.00
IGL01651:Morc2a APN 11 3658727 critical splice donor site probably null
IGL02860:Morc2a APN 11 3661821 splice site probably benign
IGL03372:Morc2a APN 11 3681813 splice site probably benign
R0136:Morc2a UTSW 11 3685907 intron probably null
R0267:Morc2a UTSW 11 3678567 missense probably benign 0.03
R0279:Morc2a UTSW 11 3683989 missense probably benign 0.09
R0556:Morc2a UTSW 11 3681809 critical splice donor site probably null
R1084:Morc2a UTSW 11 3650454 splice site probably benign
R1148:Morc2a UTSW 11 3678557 missense probably benign 0.00
R1148:Morc2a UTSW 11 3678557 missense probably benign 0.00
R1341:Morc2a UTSW 11 3680216 missense possibly damaging 0.80
R1460:Morc2a UTSW 11 3683794 missense probably benign 0.01
R1493:Morc2a UTSW 11 3678557 missense probably benign 0.00
R1665:Morc2a UTSW 11 3675885 missense probably benign 0.00
R1668:Morc2a UTSW 11 3675885 missense probably benign 0.00
R1669:Morc2a UTSW 11 3675885 missense probably benign 0.00
R1812:Morc2a UTSW 11 3685831 missense probably damaging 0.98
R2132:Morc2a UTSW 11 3679787 missense possibly damaging 0.89
R2133:Morc2a UTSW 11 3680302 nonsense probably null
R2200:Morc2a UTSW 11 3683919 missense probably benign 0.00
R2698:Morc2a UTSW 11 3685400 missense probably damaging 1.00
R3236:Morc2a UTSW 11 3683612 missense probably benign
R3698:Morc2a UTSW 11 3679672 nonsense probably null
R4119:Morc2a UTSW 11 3683868 missense probably benign 0.00
R4898:Morc2a UTSW 11 3676664 nonsense probably null
R5148:Morc2a UTSW 11 3689084 missense probably damaging 1.00
R5228:Morc2a UTSW 11 3685439 missense probably damaging 0.96
R5395:Morc2a UTSW 11 3688232 missense possibly damaging 0.94
R5808:Morc2a UTSW 11 3683781 missense probably benign 0.00
R5942:Morc2a UTSW 11 3679936 missense probably damaging 1.00
R6634:Morc2a UTSW 11 3672376 critical splice donor site probably null
R7056:Morc2a UTSW 11 3675925 missense probably damaging 1.00
R7537:Morc2a UTSW 11 3683566 nonsense probably null
R8014:Morc2a UTSW 11 3677419 missense probably damaging 1.00
RF013:Morc2a UTSW 11 3676191 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCAGGCACATAGTGAGGATC -3'
(R):5'- GTACTAGTTTCTCCTCGGGC -3'

Sequencing Primer
(F):5'- CAGGCACATAGTGAGGATCCAAAG -3'
(R):5'- TCTCCTCGGGCTGCTGTAG -3'
Posted On2015-03-18