Incidental Mutation 'R3760:Serpinb3d'
ID270492
Institutional Source Beutler Lab
Gene Symbol Serpinb3d
Ensembl Gene ENSMUSG00000058017
Gene Nameserine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3D
Synonyms
MMRRC Submission 040740-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3760 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location107078167-107083506 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 107081574 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023861]
Predicted Effect probably benign
Transcript: ENSMUST00000023861
SMART Domains Protein: ENSMUSP00000023861
Gene: ENSMUSG00000058017

DomainStartEndE-ValueType
SERPIN 13 387 2.44e-169 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,817,235 E1448G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Ell2 A T 13: 75,762,162 Q163L probably benign Het
Epha6 T A 16: 60,220,984 T423S possibly damaging Het
Fhad1 T C 4: 141,909,813 E1114G probably damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gm9268 G A 7: 43,024,078 E187K probably benign Het
Gpr83 A T 9: 14,860,738 T69S probably benign Het
Gramd1c A T 16: 43,997,791 M342K probably damaging Het
Hist1h3f T C 13: 23,544,815 C111R probably damaging Het
Idua T C 5: 108,670,112 probably benign Het
Kcnh1 T C 1: 192,506,024 L931P probably damaging Het
Map2 T A 1: 66,438,918 S470T probably damaging Het
Map7 T C 10: 20,276,281 probably benign Het
Obscn A G 11: 59,028,580 L6213P probably damaging Het
Olfr1085 G A 2: 86,657,888 S190L possibly damaging Het
Olfr1463 T C 19: 13,234,886 L212P probably damaging Het
Pcnx4 C T 12: 72,567,006 T575M probably damaging Het
Ppp1r12a A G 10: 108,264,734 D348G probably damaging Het
Prrc2c T C 1: 162,692,851 N730S probably damaging Het
Skint6 T C 4: 112,937,458 T705A possibly damaging Het
Slc6a20a A G 9: 123,662,989 I50T probably damaging Het
Taf13 T C 3: 108,578,108 probably benign Het
Tlr11 A T 14: 50,362,243 E562V probably damaging Het
Uhrf2 T C 19: 30,073,931 S302P probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc79 T A 12: 103,092,705 L1036Q probably damaging Het
Vmn1r85 A T 7: 13,085,005 S71T probably damaging Het
Vps52 T C 17: 33,960,188 F200L possibly damaging Het
Zfp521 T C 18: 13,844,629 H909R possibly damaging Het
Other mutations in Serpinb3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01582:Serpinb3d APN 1 107079666 missense probably damaging 1.00
IGL01917:Serpinb3d APN 1 107079681 missense probably damaging 1.00
IGL02732:Serpinb3d APN 1 107082796 critical splice acceptor site probably null
IGL02988:Serpinb3d UTSW 1 107078536 missense probably benign
R0540:Serpinb3d UTSW 1 107079232 missense probably benign 0.01
R0594:Serpinb3d UTSW 1 107079347 missense probably damaging 1.00
R1666:Serpinb3d UTSW 1 107080751 missense probably benign 0.18
R1668:Serpinb3d UTSW 1 107080751 missense probably benign 0.18
R1905:Serpinb3d UTSW 1 107079284 missense possibly damaging 0.71
R1994:Serpinb3d UTSW 1 107080788 missense possibly damaging 0.52
R2021:Serpinb3d UTSW 1 107078452 missense probably benign 0.05
R2022:Serpinb3d UTSW 1 107078452 missense probably benign 0.05
R4118:Serpinb3d UTSW 1 107079230 missense possibly damaging 0.58
R4496:Serpinb3d UTSW 1 107079292 missense probably damaging 0.98
R4770:Serpinb3d UTSW 1 107078278 missense probably damaging 1.00
R4793:Serpinb3d UTSW 1 107078221 missense probably damaging 1.00
R5174:Serpinb3d UTSW 1 107078498 missense possibly damaging 0.63
R5434:Serpinb3d UTSW 1 107078533 missense probably benign 0.02
R5813:Serpinb3d UTSW 1 107079297 missense probably benign 0.14
R5820:Serpinb3d UTSW 1 107078359 missense probably damaging 0.99
R5935:Serpinb3d UTSW 1 107083375 missense probably benign 0.00
R6056:Serpinb3d UTSW 1 107079722 missense probably damaging 1.00
R6092:Serpinb3d UTSW 1 107079259 missense probably damaging 1.00
R6188:Serpinb3d UTSW 1 107078507 missense probably damaging 0.98
R6247:Serpinb3d UTSW 1 107082760 missense probably benign 0.01
R6369:Serpinb3d UTSW 1 107080753 missense probably benign 0.00
R6476:Serpinb3d UTSW 1 107083341 missense probably benign 0.09
R7178:Serpinb3d UTSW 1 107080776 missense possibly damaging 0.72
R7743:Serpinb3d UTSW 1 107079358 missense probably damaging 0.99
R7765:Serpinb3d UTSW 1 107079782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTTTGTACAATCCAGTGAG -3'
(R):5'- AAAAGTGGTCTTTGCAAGAGTTTGG -3'

Sequencing Primer
(F):5'- GTACAATCCAGTGAGTTAGACTTTTG -3'
(R):5'- TGCAAGAGTTTGGTGTTTATTTTG -3'
Posted On2015-03-18