Incidental Mutation 'R3761:Wwp1'
ID270530
Institutional Source Beutler Lab
Gene Symbol Wwp1
Ensembl Gene ENSMUSG00000041058
Gene NameWW domain containing E3 ubiquitin protein ligase 1
SynonymsTiul1, SDRP1, 8030445B08Rik, AIP5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3761 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location19608303-19708993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19631085 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 649 (H649Q)
Ref Sequence ENSEMBL: ENSMUSP00000103881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035982] [ENSMUST00000108246] [ENSMUST00000108250]
Predicted Effect probably damaging
Transcript: ENSMUST00000035982
AA Change: H649Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041627
Gene: ENSMUSG00000041058
AA Change: H649Q

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108246
AA Change: H649Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103881
Gene: ENSMUSG00000041058
AA Change: H649Q

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108250
SMART Domains Protein: ENSMUSP00000103885
Gene: ENSMUSG00000078772

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 4 tandem WW domains and a HECT (homologous to the E6-associated protein carboxyl terminus) domain. The encoded protein belongs to a family of NEDD4-like proteins, which are E3 ubiquitin-ligase molecules and regulate key trafficking decisions, including targeting of proteins to proteosomes or lysosomes. Alternative splicing of this gene generates at least 6 transcript variants; however, the full length nature of these transcripts has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased osteoblast differentiation of bone marrow-derived stromal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl A G 9: 110,898,134 T923A probably damaging Het
Ccdc91 A T 6: 147,562,702 D216V unknown Het
Clstn3 A G 6: 124,457,876 V360A possibly damaging Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Eif3e C T 15: 43,261,084 R346H probably damaging Het
Esrp2 T C 8: 106,133,622 D301G probably damaging Het
Fam174a G T 1: 95,314,246 V144F probably damaging Het
Fbxo31 A T 8: 121,560,430 W135R possibly damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Heatr5b A G 17: 78,829,642 S150P probably damaging Het
Il16 A G 7: 83,650,885 L400S possibly damaging Het
Olfr934 A T 9: 38,982,366 I226N possibly damaging Het
Ryr3 A G 2: 112,754,913 F2776S probably benign Het
Sema3d T C 5: 12,571,037 Y537H probably damaging Het
Sh3pxd2b T C 11: 32,422,750 V639A probably benign Het
Slc39a10 A G 1: 46,812,125 V735A possibly damaging Het
Slc45a2 T A 15: 11,012,714 Y268N probably benign Het
Tmco5 A G 2: 116,887,306 probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Other mutations in Wwp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Wwp1 APN 4 19650360 missense probably benign
IGL00945:Wwp1 APN 4 19640193 critical splice donor site probably null
IGL01338:Wwp1 APN 4 19627636 missense probably damaging 1.00
IGL01960:Wwp1 APN 4 19662115 splice site probably benign
IGL02969:Wwp1 APN 4 19623200 missense probably damaging 1.00
IGL03137:Wwp1 APN 4 19678408 missense probably damaging 0.97
PIT4243001:Wwp1 UTSW 4 19638631 missense probably damaging 0.99
R0035:Wwp1 UTSW 4 19631116 missense probably damaging 1.00
R0109:Wwp1 UTSW 4 19641725 intron probably benign
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0391:Wwp1 UTSW 4 19627911 missense probably damaging 1.00
R0464:Wwp1 UTSW 4 19638763 intron probably benign
R1604:Wwp1 UTSW 4 19659709 missense probably benign
R1716:Wwp1 UTSW 4 19659698 missense probably benign 0.00
R1778:Wwp1 UTSW 4 19627892 nonsense probably null
R1832:Wwp1 UTSW 4 19650197 missense probably benign 0.33
R2073:Wwp1 UTSW 4 19662181 missense possibly damaging 0.89
R2094:Wwp1 UTSW 4 19650390 missense probably benign 0.00
R2228:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2229:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2267:Wwp1 UTSW 4 19638618 missense probably damaging 1.00
R2334:Wwp1 UTSW 4 19662032 missense probably benign 0.07
R2349:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R4062:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R4731:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4732:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4733:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4838:Wwp1 UTSW 4 19662143 missense probably benign 0.31
R4936:Wwp1 UTSW 4 19638804 missense probably damaging 0.96
R5262:Wwp1 UTSW 4 19631057 missense probably damaging 1.00
R5340:Wwp1 UTSW 4 19638773 critical splice donor site probably null
R5847:Wwp1 UTSW 4 19662174 missense possibly damaging 0.95
R6492:Wwp1 UTSW 4 19650299 missense possibly damaging 0.94
R6602:Wwp1 UTSW 4 19641816 missense probably damaging 1.00
R6628:Wwp1 UTSW 4 19661963 splice site probably null
R7017:Wwp1 UTSW 4 19623124 missense probably damaging 1.00
R7195:Wwp1 UTSW 4 19627908 missense possibly damaging 0.84
R7276:Wwp1 UTSW 4 19611782 missense probably damaging 1.00
R7450:Wwp1 UTSW 4 19640016 missense probably damaging 0.99
R7488:Wwp1 UTSW 4 19627660 missense probably damaging 0.99
R7617:Wwp1 UTSW 4 19662188 missense probably benign 0.00
R7707:Wwp1 UTSW 4 19627645 missense probably benign 0.31
R7812:Wwp1 UTSW 4 19639991 missense probably damaging 0.99
R7864:Wwp1 UTSW 4 19635328 missense probably damaging 1.00
R7947:Wwp1 UTSW 4 19635328 missense probably damaging 1.00
R8006:Wwp1 UTSW 4 19650174 missense probably benign
X0018:Wwp1 UTSW 4 19640261 missense probably benign 0.41
X0062:Wwp1 UTSW 4 19638794 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGCTTGTAACTAAGGGAGGATATAG -3'
(R):5'- TGTGCAGAGTTAGCAGGACTG -3'

Sequencing Primer
(F):5'- TATCGGAATTACATGCAGGCC -3'
(R):5'- CCTGCATGTATGTGTATGTGCATGC -3'
Posted On2015-03-18