Incidental Mutation 'R3761:Eif3e'
ID270543
Institutional Source Beutler Lab
Gene Symbol Eif3e
Ensembl Gene ENSMUSG00000022336
Gene Nameeukaryotic translation initiation factor 3, subunit E
SynonymsEif3s6, eIF3-p46, 48kDa, Int6, eIF3-p48
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R3761 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location43250058-43282719 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43261084 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 346 (R346H)
Ref Sequence ENSEMBL: ENSMUSP00000022960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022960]
Predicted Effect probably damaging
Transcript: ENSMUST00000022960
AA Change: R346H

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022960
Gene: ENSMUSG00000022336
AA Change: R346H

DomainStartEndE-ValueType
eIF3_N 5 138 4.88e-70 SMART
Blast:eIF3_N 157 193 2e-14 BLAST
Blast:PINT 218 251 7e-9 BLAST
Blast:PINT 284 315 3e-13 BLAST
PINT 327 411 8.17e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228892
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl A G 9: 110,898,134 T923A probably damaging Het
Ccdc91 A T 6: 147,562,702 D216V unknown Het
Clstn3 A G 6: 124,457,876 V360A possibly damaging Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Esrp2 T C 8: 106,133,622 D301G probably damaging Het
Fam174a G T 1: 95,314,246 V144F probably damaging Het
Fbxo31 A T 8: 121,560,430 W135R possibly damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Heatr5b A G 17: 78,829,642 S150P probably damaging Het
Il16 A G 7: 83,650,885 L400S possibly damaging Het
Olfr934 A T 9: 38,982,366 I226N possibly damaging Het
Ryr3 A G 2: 112,754,913 F2776S probably benign Het
Sema3d T C 5: 12,571,037 Y537H probably damaging Het
Sh3pxd2b T C 11: 32,422,750 V639A probably benign Het
Slc39a10 A G 1: 46,812,125 V735A possibly damaging Het
Slc45a2 T A 15: 11,012,714 Y268N probably benign Het
Tmco5 A G 2: 116,887,306 probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Wwp1 A T 4: 19,631,085 H649Q probably damaging Het
Other mutations in Eif3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Eif3e APN 15 43278349 missense probably benign 0.17
IGL02333:Eif3e APN 15 43266137 missense probably benign 0.37
IGL02669:Eif3e APN 15 43282692 start codon destroyed probably benign
IGL03119:Eif3e APN 15 43265604 missense probably benign
IGL03200:Eif3e APN 15 43252261 missense probably damaging 1.00
Verdugo UTSW 15 43272289 missense probably benign 0.29
R0152:Eif3e UTSW 15 43252236 missense possibly damaging 0.83
R1439:Eif3e UTSW 15 43278428 splice site probably benign
R1613:Eif3e UTSW 15 43250224 missense possibly damaging 0.81
R1997:Eif3e UTSW 15 43265609 missense probably damaging 1.00
R2221:Eif3e UTSW 15 43251547 missense possibly damaging 0.95
R4241:Eif3e UTSW 15 43262690 missense probably damaging 0.97
R4571:Eif3e UTSW 15 43266162 missense possibly damaging 0.74
R5061:Eif3e UTSW 15 43252261 missense probably damaging 1.00
R5227:Eif3e UTSW 15 43251521 missense probably benign 0.01
R5367:Eif3e UTSW 15 43252304 missense probably damaging 1.00
R5417:Eif3e UTSW 15 43265521 missense probably benign 0.00
R5497:Eif3e UTSW 15 43270970 missense probably damaging 0.98
R5928:Eif3e UTSW 15 43275332 splice site probably null
R6083:Eif3e UTSW 15 43266144 missense probably damaging 1.00
R6337:Eif3e UTSW 15 43252296 missense possibly damaging 0.95
R6964:Eif3e UTSW 15 43272289 missense probably benign 0.29
R7692:Eif3e UTSW 15 43263246 missense probably damaging 0.98
R7825:Eif3e UTSW 15 43266271 splice site probably null
R8034:Eif3e UTSW 15 43272307 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGGCTTCAACTTGTCATTTCC -3'
(R):5'- CGTGAGCAACATTCTAAAGAGTAC -3'

Sequencing Primer
(F):5'- GCTTCAACTTGTCATTTCCAGAAAAC -3'
(R):5'- ATGCTGTGTATCTAGGTGC -3'
Posted On2015-03-18