Incidental Mutation 'R3762:Pak6'
ID270547
Institutional Source Beutler Lab
Gene Symbol Pak6
Ensembl Gene ENSMUSG00000074923
Gene Namep21 (RAC1) activated kinase 6
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3762 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location118663303-118698020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118696477 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 651 (Q651L)
Ref Sequence ENSEMBL: ENSMUSP00000106477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099557] [ENSMUST00000104937] [ENSMUST00000110853]
Predicted Effect probably damaging
Transcript: ENSMUST00000099557
AA Change: Q651L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097153
Gene: ENSMUSG00000074923
AA Change: Q651L

DomainStartEndE-ValueType
PBD 12 47 4.47e-11 SMART
S_TKc 408 659 2.38e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000104937
SMART Domains Protein: ENSMUSP00000100542
Gene: ENSMUSG00000078137

DomainStartEndE-ValueType
ANK 46 79 1.87e0 SMART
ANK 83 112 3.23e-4 SMART
ANK 116 145 3.44e1 SMART
low complexity region 193 247 N/A INTRINSIC
low complexity region 331 341 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110853
AA Change: Q651L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106477
Gene: ENSMUSG00000074923
AA Change: Q651L

DomainStartEndE-ValueType
PBD 12 47 4.47e-11 SMART
S_TKc 408 659 2.38e-89 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132577
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of p21-stimulated serine/threonine protein kinases, which contain an amino-terminal Cdc42/Rac interactive binding (CRIB) domain and a carboxyl-terminal kinase domain. These kinases function in a number of cellular processes, including cytoskeleton rearrangement, apoptosis, and the mitogen-activated protein (MAP) kinase signaling pathway. The protein encoded by this gene interacts with androgen receptor (AR) and translocates to the nucleus, where it is involved in transcriptional regulation. Changes in expression of this gene have been linked to prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele do not exhibit any abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A T 7: 16,565,075 S22T probably damaging Het
Atp2b1 T C 10: 99,009,489 I718T probably damaging Het
Cad T A 5: 31,075,546 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Dnah17 T A 11: 118,104,526 M999L probably benign Het
Dpysl4 A G 7: 139,096,756 E374G probably damaging Het
Gatad2a T C 8: 69,916,280 probably null Het
Gm15293 C T 8: 21,201,737 S45F probably damaging Het
Gm826 C A 2: 160,313,503 probably benign Het
H2-M10.1 T A 17: 36,325,324 H117L probably damaging Het
Klhl9 A T 4: 88,721,593 V137D possibly damaging Het
Limch1 A G 5: 67,028,840 Y828C probably damaging Het
Med1 T C 11: 98,155,515 probably benign Het
Muc5ac A T 7: 141,807,475 T1507S possibly damaging Het
Plscr2 T A 9: 92,291,080 V90D probably damaging Het
Rbbp4 G A 4: 129,334,551 T2I probably damaging Het
Rnf121 G A 7: 102,024,037 T223M probably damaging Het
Rsph6a A G 7: 19,055,331 K196R probably damaging Het
Tex47 A T 5: 7,305,529 I237L probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r30 C A 6: 58,435,293 V185L probably benign Het
Vmn2r103 A T 17: 19,812,149 E728D probably damaging Het
Vmn2r14 A T 5: 109,220,167 Y320N probably benign Het
Zc3h14 T A 12: 98,758,643 F188Y probably damaging Het
Other mutations in Pak6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Pak6 APN 2 118689845 missense possibly damaging 0.58
IGL00979:Pak6 APN 2 118696482 missense probably damaging 1.00
IGL01577:Pak6 APN 2 118693648 missense probably benign 0.00
IGL01928:Pak6 APN 2 118689864 missense probably damaging 1.00
IGL01951:Pak6 APN 2 118693260 missense probably benign
IGL02387:Pak6 APN 2 118693233 missense probably benign
IGL03302:Pak6 APN 2 118693303 missense probably benign
bedamned UTSW 2 118694007 splice site probably benign
bequeathed UTSW 2 118693522 missense probably damaging 0.96
R0126:Pak6 UTSW 2 118690332 missense possibly damaging 0.86
R0883:Pak6 UTSW 2 118693687 missense probably damaging 1.00
R1128:Pak6 UTSW 2 118696509 missense probably benign 0.00
R2073:Pak6 UTSW 2 118688851 missense probably damaging 1.00
R2508:Pak6 UTSW 2 118694569 nonsense probably null
R2920:Pak6 UTSW 2 118694007 splice site probably benign
R3118:Pak6 UTSW 2 118689741 missense probably damaging 1.00
R3689:Pak6 UTSW 2 118693440 nonsense probably null
R4589:Pak6 UTSW 2 118696540 missense probably damaging 1.00
R4976:Pak6 UTSW 2 118694548 missense probably damaging 1.00
R5119:Pak6 UTSW 2 118694548 missense probably damaging 1.00
R5206:Pak6 UTSW 2 118693303 missense probably benign
R5683:Pak6 UTSW 2 118693912 missense probably damaging 1.00
R7232:Pak6 UTSW 2 118693522 missense probably damaging 0.96
R7236:Pak6 UTSW 2 118693428 missense probably benign 0.26
R7292:Pak6 UTSW 2 118693591 missense possibly damaging 0.95
R7623:Pak6 UTSW 2 118694587 missense probably damaging 1.00
R7823:Pak6 UTSW 2 118695312 missense probably benign 0.02
R8190:Pak6 UTSW 2 118690097 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCCAATCATCAGTGCGCC -3'
(R):5'- CGATCTTTGGAGAGAACACTGAG -3'

Sequencing Primer
(F):5'- AATCATCAGTGCGCCTGGGAG -3'
(R):5'- CTTTGGAGAGAACACTGAGAGGGC -3'
Posted On2015-03-18