Incidental Mutation 'R3762:Rbbp4'
ID270549
Institutional Source Beutler Lab
Gene Symbol Rbbp4
Ensembl Gene ENSMUSG00000057236
Gene Nameretinoblastoma binding protein 4, chromatin remodeling factor
SynonymsCAF-1 p48 subunit, RBAP48
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3762 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129307100-129335370 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129334551 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 2 (T2I)
Ref Sequence ENSEMBL: ENSMUSP00000116517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102598] [ENSMUST00000119480] [ENSMUST00000135585] [ENSMUST00000141235] [ENSMUST00000146767]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102598
AA Change: T37I

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099658
Gene: ENSMUSG00000057236
AA Change: T37I

DomainStartEndE-ValueType
Pfam:CAF1C_H4-bd 19 88 1.3e-28 PFAM
WD40 112 153 8.25e0 SMART
WD40 166 206 2.07e-6 SMART
WD40 216 256 4.48e-2 SMART
WD40 262 302 5.81e-10 SMART
WD40 306 346 3.93e-7 SMART
WD40 363 403 1.08e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106047
Predicted Effect probably benign
Transcript: ENSMUST00000119480
SMART Domains Protein: ENSMUSP00000113004
Gene: ENSMUSG00000057572

DomainStartEndE-ValueType
Pfam:Archease 31 119 4.6e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135585
AA Change: T2I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140291
Predicted Effect probably benign
Transcript: ENSMUST00000141235
SMART Domains Protein: ENSMUSP00000120925
Gene: ENSMUSG00000057572

DomainStartEndE-ValueType
Pfam:Archease 31 167 3.3e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146767
SMART Domains Protein: ENSMUSP00000114628
Gene: ENSMUSG00000057572

DomainStartEndE-ValueType
Pfam:Archease 31 145 3.5e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147183
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed nuclear protein which belongs to a highly conserved subfamily of WD-repeat proteins. It is present in protein complexes involved in histone acetylation and chromatin assembly. It is part of the Mi-2 complex which has been implicated in chromatin remodeling and transcriptional repression associated with histone deacetylation. This encoded protein is also part of co-repressor complexes, which is an integral component of transcriptional silencing. It is found among several cellular proteins that bind directly to retinoblastoma protein to regulate cell proliferation. This protein also seems to be involved in transcriptional repression of E2F-responsive genes. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A T 7: 16,565,075 S22T probably damaging Het
Atp2b1 T C 10: 99,009,489 I718T probably damaging Het
Cad T A 5: 31,075,546 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Dnah17 T A 11: 118,104,526 M999L probably benign Het
Dpysl4 A G 7: 139,096,756 E374G probably damaging Het
Gatad2a T C 8: 69,916,280 probably null Het
Gm15293 C T 8: 21,201,737 S45F probably damaging Het
Gm826 C A 2: 160,313,503 probably benign Het
H2-M10.1 T A 17: 36,325,324 H117L probably damaging Het
Klhl9 A T 4: 88,721,593 V137D possibly damaging Het
Limch1 A G 5: 67,028,840 Y828C probably damaging Het
Med1 T C 11: 98,155,515 probably benign Het
Muc5ac A T 7: 141,807,475 T1507S possibly damaging Het
Pak6 A T 2: 118,696,477 Q651L probably damaging Het
Plscr2 T A 9: 92,291,080 V90D probably damaging Het
Rnf121 G A 7: 102,024,037 T223M probably damaging Het
Rsph6a A G 7: 19,055,331 K196R probably damaging Het
Tex47 A T 5: 7,305,529 I237L probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r30 C A 6: 58,435,293 V185L probably benign Het
Vmn2r103 A T 17: 19,812,149 E728D probably damaging Het
Vmn2r14 A T 5: 109,220,167 Y320N probably benign Het
Zc3h14 T A 12: 98,758,643 F188Y probably damaging Het
Other mutations in Rbbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Rbbp4 APN 4 129310153 missense probably benign 0.06
IGL01150:Rbbp4 APN 4 129322875 splice site probably benign
IGL02228:Rbbp4 APN 4 129317750 missense probably damaging 1.00
R0864:Rbbp4 UTSW 4 129320551 splice site probably benign
R1056:Rbbp4 UTSW 4 129317649 missense probably damaging 0.99
R3717:Rbbp4 UTSW 4 129328632 missense probably benign 0.02
R6148:Rbbp4 UTSW 4 129321958 missense probably benign
R6593:Rbbp4 UTSW 4 129322375 missense probably damaging 1.00
R6676:Rbbp4 UTSW 4 129328621 missense probably benign
R7741:Rbbp4 UTSW 4 129334563 missense probably damaging 0.99
R8045:Rbbp4 UTSW 4 129317900 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTCAACTCCATGCTGAGGG -3'
(R):5'- TCGTTGTCAAAATCCGGGC -3'

Sequencing Primer
(F):5'- TGGTGGCTCACAACAATCTG -3'
(R):5'- TTGTCAAAATCCGGGCGCTAC -3'
Posted On2015-03-18