Incidental Mutation 'R3762:Tex47'
ID270550
Institutional Source Beutler Lab
Gene Symbol Tex47
Ensembl Gene ENSMUSG00000040514
Gene Nametestis expressed 47
Synonyms4921511H03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R3762 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location7304119-7311491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7305529 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 237 (I237L)
Ref Sequence ENSEMBL: ENSMUSP00000125471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088796] [ENSMUST00000159546] [ENSMUST00000160634] [ENSMUST00000200317]
Predicted Effect probably benign
Transcript: ENSMUST00000088796
AA Change: I237L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000086176
Gene: ENSMUSG00000040514
AA Change: I237L

DomainStartEndE-ValueType
Blast:BLUF 47 146 2e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159546
AA Change: I237L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124368
Gene: ENSMUSG00000040514
AA Change: I237L

DomainStartEndE-ValueType
Blast:BLUF 47 146 2e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160634
AA Change: I237L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000125471
Gene: ENSMUSG00000040514
AA Change: I237L

DomainStartEndE-ValueType
Blast:BLUF 47 146 2e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196680
Predicted Effect probably benign
Transcript: ENSMUST00000200317
SMART Domains Protein: ENSMUSP00000143568
Gene: ENSMUSG00000092094

DomainStartEndE-ValueType
ZnF_C2H2 56 80 2e-2 SMART
low complexity region 958 970 N/A INTRINSIC
low complexity region 1155 1179 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1215 1234 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A T 7: 16,565,075 S22T probably damaging Het
Atp2b1 T C 10: 99,009,489 I718T probably damaging Het
Cad T A 5: 31,075,546 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Dnah17 T A 11: 118,104,526 M999L probably benign Het
Dpysl4 A G 7: 139,096,756 E374G probably damaging Het
Gatad2a T C 8: 69,916,280 probably null Het
Gm15293 C T 8: 21,201,737 S45F probably damaging Het
Gm826 C A 2: 160,313,503 probably benign Het
H2-M10.1 T A 17: 36,325,324 H117L probably damaging Het
Klhl9 A T 4: 88,721,593 V137D possibly damaging Het
Limch1 A G 5: 67,028,840 Y828C probably damaging Het
Med1 T C 11: 98,155,515 probably benign Het
Muc5ac A T 7: 141,807,475 T1507S possibly damaging Het
Pak6 A T 2: 118,696,477 Q651L probably damaging Het
Plscr2 T A 9: 92,291,080 V90D probably damaging Het
Rbbp4 G A 4: 129,334,551 T2I probably damaging Het
Rnf121 G A 7: 102,024,037 T223M probably damaging Het
Rsph6a A G 7: 19,055,331 K196R probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r30 C A 6: 58,435,293 V185L probably benign Het
Vmn2r103 A T 17: 19,812,149 E728D probably damaging Het
Vmn2r14 A T 5: 109,220,167 Y320N probably benign Het
Zc3h14 T A 12: 98,758,643 F188Y probably damaging Het
Other mutations in Tex47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tex47 APN 5 7305468 nonsense probably null
IGL00673:Tex47 APN 5 7305211 missense probably damaging 1.00
PIT4495001:Tex47 UTSW 5 7305011 missense probably benign 0.34
R0648:Tex47 UTSW 5 7305215 missense probably benign 0.04
R1911:Tex47 UTSW 5 7305022 missense probably damaging 0.98
R2163:Tex47 UTSW 5 7305022 missense probably damaging 0.98
R3690:Tex47 UTSW 5 7304777 intron probably benign
R4423:Tex47 UTSW 5 7305364 missense probably benign 0.10
R4424:Tex47 UTSW 5 7305364 missense probably benign 0.10
R5107:Tex47 UTSW 5 7304842 missense probably benign 0.01
R5379:Tex47 UTSW 5 7304843 missense probably null 0.01
R5589:Tex47 UTSW 5 7304834 missense probably benign
R6265:Tex47 UTSW 5 7305461 missense probably damaging 1.00
R6325:Tex47 UTSW 5 7304935 nonsense probably null
R6580:Tex47 UTSW 5 7305212 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGCACTCCAACTTTACAAG -3'
(R):5'- AGCTTCATACTACAACAAGCAGATG -3'

Sequencing Primer
(F):5'- CTTTACAAGACAGTGAAATTGGGC -3'
(R):5'- GCAGATGTATTCCTATGTTTAGCTC -3'
Posted On2015-03-18