Incidental Mutation 'R3762:Dpysl4'
ID270559
Institutional Source Beutler Lab
Gene Symbol Dpysl4
Ensembl Gene ENSMUSG00000025478
Gene Namedihydropyrimidinase-like 4
SynonymsDrp-4, Ulip4, Crmp3, CRMP-3, unc-33-like phosphoprotein 4, DPY4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R3762 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location139086001-139102704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139096756 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 374 (E374G)
Ref Sequence ENSEMBL: ENSMUSP00000112896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026551] [ENSMUST00000121184] [ENSMUST00000145499]
Predicted Effect probably damaging
Transcript: ENSMUST00000026551
AA Change: E353G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026551
Gene: ENSMUSG00000025478
AA Change: E353G

DomainStartEndE-ValueType
Pfam:Amidohydro_1 64 453 4.5e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121184
AA Change: E374G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112896
Gene: ENSMUSG00000025478
AA Change: E374G

DomainStartEndE-ValueType
Pfam:Amidohydro_1 85 474 1.1e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139364
Predicted Effect probably benign
Transcript: ENSMUST00000145499
SMART Domains Protein: ENSMUSP00000117764
Gene: ENSMUSG00000025478

DomainStartEndE-ValueType
Pfam:Amidohydro_1 1 148 2.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154273
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit abnormal neurite outgrowth and lamination in the hippocampus, altered dendrite arborization and spine morphology in hippocampal pyramidal cells, and impaired LTP induction in the CA1 region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A T 7: 16,565,075 S22T probably damaging Het
Atp2b1 T C 10: 99,009,489 I718T probably damaging Het
Cad T A 5: 31,075,546 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Dnah17 T A 11: 118,104,526 M999L probably benign Het
Gatad2a T C 8: 69,916,280 probably null Het
Gm15293 C T 8: 21,201,737 S45F probably damaging Het
Gm826 C A 2: 160,313,503 probably benign Het
H2-M10.1 T A 17: 36,325,324 H117L probably damaging Het
Klhl9 A T 4: 88,721,593 V137D possibly damaging Het
Limch1 A G 5: 67,028,840 Y828C probably damaging Het
Med1 T C 11: 98,155,515 probably benign Het
Muc5ac A T 7: 141,807,475 T1507S possibly damaging Het
Pak6 A T 2: 118,696,477 Q651L probably damaging Het
Plscr2 T A 9: 92,291,080 V90D probably damaging Het
Rbbp4 G A 4: 129,334,551 T2I probably damaging Het
Rnf121 G A 7: 102,024,037 T223M probably damaging Het
Rsph6a A G 7: 19,055,331 K196R probably damaging Het
Tex47 A T 5: 7,305,529 I237L probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r30 C A 6: 58,435,293 V185L probably benign Het
Vmn2r103 A T 17: 19,812,149 E728D probably damaging Het
Vmn2r14 A T 5: 109,220,167 Y320N probably benign Het
Zc3h14 T A 12: 98,758,643 F188Y probably damaging Het
Other mutations in Dpysl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Dpysl4 APN 7 139096176 missense probably damaging 1.00
IGL01836:Dpysl4 APN 7 139096173 missense possibly damaging 0.96
IGL02447:Dpysl4 APN 7 139098600 missense probably damaging 1.00
IGL02515:Dpysl4 APN 7 139096735 missense probably damaging 1.00
IGL03169:Dpysl4 APN 7 139099910 splice site probably null
PIT4382001:Dpysl4 UTSW 7 139089578 nonsense probably null
R0012:Dpysl4 UTSW 7 139097883 missense probably benign 0.32
R0012:Dpysl4 UTSW 7 139097883 missense probably benign 0.32
R1624:Dpysl4 UTSW 7 139089553 missense probably damaging 1.00
R1642:Dpysl4 UTSW 7 139090338 missense probably damaging 1.00
R1860:Dpysl4 UTSW 7 139090299 missense probably benign
R1885:Dpysl4 UTSW 7 139096807 missense probably damaging 1.00
R1995:Dpysl4 UTSW 7 139096770 missense probably benign
R2698:Dpysl4 UTSW 7 139096765 missense probably damaging 1.00
R3032:Dpysl4 UTSW 7 139096236 missense probably benign 0.01
R3851:Dpysl4 UTSW 7 139100935 missense probably damaging 1.00
R3852:Dpysl4 UTSW 7 139100935 missense probably damaging 1.00
R4609:Dpysl4 UTSW 7 139098621 missense probably damaging 0.99
R4972:Dpysl4 UTSW 7 139090290 missense probably damaging 1.00
R5538:Dpysl4 UTSW 7 139091990 missense probably benign
R5608:Dpysl4 UTSW 7 139098543 missense probably damaging 0.97
R5762:Dpysl4 UTSW 7 139091937 missense probably benign
R5887:Dpysl4 UTSW 7 139096276 missense possibly damaging 0.72
R6022:Dpysl4 UTSW 7 139086084 unclassified probably benign
R6060:Dpysl4 UTSW 7 139089408 start codon destroyed probably null
R6180:Dpysl4 UTSW 7 139090334 missense probably damaging 1.00
R6328:Dpysl4 UTSW 7 139099818 missense probably benign
R6809:Dpysl4 UTSW 7 139093660 missense probably benign 0.19
R6949:Dpysl4 UTSW 7 139091999 missense probably damaging 1.00
R7647:Dpysl4 UTSW 7 139099773 missense possibly damaging 0.92
R7695:Dpysl4 UTSW 7 139086123 start codon destroyed probably null 0.00
R7751:Dpysl4 UTSW 7 139089540 missense probably benign
R8129:Dpysl4 UTSW 7 139086160 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGTTCCATAGCCTTGGCTTGC -3'
(R):5'- TAGGTGTCACTGCTAGGTGC -3'

Sequencing Primer
(F):5'- CTGCCTAGGAAGCTGGAGC -3'
(R):5'- TGCCGTCACTGCTAAGCTAAG -3'
Posted On2015-03-18