Incidental Mutation 'R3762:Gm15293'
ID270561
Institutional Source Beutler Lab
Gene Symbol Gm15293
Ensembl Gene ENSMUSG00000079116
Gene Namepredicted gene 15293
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3762 (G1)
Quality Score134
Status Not validated
Chromosome8
Chromosomal Location21201561-21202539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21201737 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 45 (S45F)
Ref Sequence ENSEMBL: ENSMUSP00000106382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110754]
Predicted Effect probably damaging
Transcript: ENSMUST00000110754
AA Change: S45F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106382
Gene: ENSMUSG00000079116
AA Change: S45F

DomainStartEndE-ValueType
Pfam:Defensin_propep 1 51 3.5e-24 PFAM
DEFSN 64 92 7.12e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A T 7: 16,565,075 S22T probably damaging Het
Atp2b1 T C 10: 99,009,489 I718T probably damaging Het
Cad T A 5: 31,075,546 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Dnah17 T A 11: 118,104,526 M999L probably benign Het
Dpysl4 A G 7: 139,096,756 E374G probably damaging Het
Gatad2a T C 8: 69,916,280 probably null Het
Gm826 C A 2: 160,313,503 probably benign Het
H2-M10.1 T A 17: 36,325,324 H117L probably damaging Het
Klhl9 A T 4: 88,721,593 V137D possibly damaging Het
Limch1 A G 5: 67,028,840 Y828C probably damaging Het
Med1 T C 11: 98,155,515 probably benign Het
Muc5ac A T 7: 141,807,475 T1507S possibly damaging Het
Pak6 A T 2: 118,696,477 Q651L probably damaging Het
Plscr2 T A 9: 92,291,080 V90D probably damaging Het
Rbbp4 G A 4: 129,334,551 T2I probably damaging Het
Rnf121 G A 7: 102,024,037 T223M probably damaging Het
Rsph6a A G 7: 19,055,331 K196R probably damaging Het
Tex47 A T 5: 7,305,529 I237L probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r30 C A 6: 58,435,293 V185L probably benign Het
Vmn2r103 A T 17: 19,812,149 E728D probably damaging Het
Vmn2r14 A T 5: 109,220,167 Y320N probably benign Het
Zc3h14 T A 12: 98,758,643 F188Y probably damaging Het
Other mutations in Gm15293
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1077:Gm15293 UTSW 8 21202433 missense probably benign 0.00
R4963:Gm15293 UTSW 8 21201758 missense probably damaging 0.98
R5170:Gm15293 UTSW 8 21201680 missense probably damaging 1.00
R6148:Gm15293 UTSW 8 21202412 missense probably benign 0.00
R6594:Gm15293 UTSW 8 21202455 utr 3 prime probably null
Predicted Primers PCR Primer
(F):5'- GGGCTCCTGCTCAACAATTC -3'
(R):5'- ATCTACTCAGAGTATTGGAGCACTC -3'

Sequencing Primer
(F):5'- TGCTCAACAATTCTCCAGGTGAC -3'
(R):5'- GGAGCACTCTTATTGTTGAAATTCCC -3'
Posted On2015-03-18