Incidental Mutation 'R3762:Cd109'
ID270563
Institutional Source Beutler Lab
Gene Symbol Cd109
Ensembl Gene ENSMUSG00000046186
Gene NameCD109 antigen
SynonymsGov platelet alloantigens, 9930012E15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3762 (G1)
Quality Score188
Status Not validated
Chromosome9
Chromosomal Location78615546-78716253 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT at 78712500 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093812]
Predicted Effect probably benign
Transcript: ENSMUST00000093812
SMART Domains Protein: ENSMUSP00000091330
Gene: ENSMUSG00000046186

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:A2M_N 129 220 1.5e-16 PFAM
A2M_N_2 470 601 8.89e-32 SMART
A2M 695 786 2.07e-32 SMART
Pfam:Thiol-ester_cl 912 941 2.6e-20 PFAM
Pfam:A2M_comp 961 1197 1.9e-65 PFAM
low complexity region 1265 1275 N/A INTRINSIC
A2M_recep 1311 1395 2.06e-27 SMART
low complexity region 1422 1437 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl phosphatidylinositol (GPI)-linked glycoprotein that localizes to the surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signalling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a null mutation display epidermal hyperplasia and thickening, sebaceous gland hyperplasia and transient impairment of hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A T 7: 16,565,075 S22T probably damaging Het
Atp2b1 T C 10: 99,009,489 I718T probably damaging Het
Cad T A 5: 31,075,546 probably null Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Dnah17 T A 11: 118,104,526 M999L probably benign Het
Dpysl4 A G 7: 139,096,756 E374G probably damaging Het
Gatad2a T C 8: 69,916,280 probably null Het
Gm15293 C T 8: 21,201,737 S45F probably damaging Het
Gm826 C A 2: 160,313,503 probably benign Het
H2-M10.1 T A 17: 36,325,324 H117L probably damaging Het
Klhl9 A T 4: 88,721,593 V137D possibly damaging Het
Limch1 A G 5: 67,028,840 Y828C probably damaging Het
Med1 T C 11: 98,155,515 probably benign Het
Muc5ac A T 7: 141,807,475 T1507S possibly damaging Het
Pak6 A T 2: 118,696,477 Q651L probably damaging Het
Plscr2 T A 9: 92,291,080 V90D probably damaging Het
Rbbp4 G A 4: 129,334,551 T2I probably damaging Het
Rnf121 G A 7: 102,024,037 T223M probably damaging Het
Rsph6a A G 7: 19,055,331 K196R probably damaging Het
Tex47 A T 5: 7,305,529 I237L probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r30 C A 6: 58,435,293 V185L probably benign Het
Vmn2r103 A T 17: 19,812,149 E728D probably damaging Het
Vmn2r14 A T 5: 109,220,167 Y320N probably benign Het
Zc3h14 T A 12: 98,758,643 F188Y probably damaging Het
Other mutations in Cd109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cd109 APN 9 78616969 missense probably damaging 1.00
IGL00465:Cd109 APN 9 78660934 nonsense probably null
IGL00667:Cd109 APN 9 78684877 missense probably damaging 0.99
IGL01432:Cd109 APN 9 78698123 missense probably benign
IGL01795:Cd109 APN 9 78661765 splice site probably benign
IGL02343:Cd109 APN 9 78688955 splice site probably benign
IGL02450:Cd109 APN 9 78695850 missense possibly damaging 0.83
IGL02699:Cd109 APN 9 78671989 splice site probably benign
IGL02738:Cd109 APN 9 78691299 missense probably damaging 1.00
IGL02797:Cd109 APN 9 78661713 missense probably damaging 0.96
IGL03160:Cd109 APN 9 78661056 splice site probably null
IGL03349:Cd109 APN 9 78636485 missense probably benign 0.34
FR4589:Cd109 UTSW 9 78712529 critical splice acceptor site probably benign
R0048:Cd109 UTSW 9 78680021 missense possibly damaging 0.50
R0060:Cd109 UTSW 9 78703107 missense probably damaging 1.00
R0060:Cd109 UTSW 9 78703107 missense probably damaging 1.00
R0158:Cd109 UTSW 9 78688932 missense possibly damaging 0.49
R0415:Cd109 UTSW 9 78712615 missense probably benign 0.13
R0659:Cd109 UTSW 9 78680170 splice site probably benign
R0709:Cd109 UTSW 9 78671978 missense possibly damaging 0.93
R0840:Cd109 UTSW 9 78664330 missense probably benign 0.04
R0909:Cd109 UTSW 9 78636473 missense probably benign 0.01
R0945:Cd109 UTSW 9 78688941 missense possibly damaging 0.51
R1344:Cd109 UTSW 9 78672550 critical splice acceptor site probably null
R1471:Cd109 UTSW 9 78654587 missense probably damaging 1.00
R1484:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R1570:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R1688:Cd109 UTSW 9 78705091 missense probably benign 0.17
R1773:Cd109 UTSW 9 78703724 missense probably benign 0.21
R1813:Cd109 UTSW 9 78617005 missense probably benign 0.04
R2004:Cd109 UTSW 9 78703762 missense probably benign 0.00
R2083:Cd109 UTSW 9 78667293 missense probably damaging 1.00
R2483:Cd109 UTSW 9 78667357 missense probably damaging 1.00
R2857:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2858:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2859:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2911:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2912:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2914:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2927:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3623:Cd109 UTSW 9 78667357 missense probably damaging 1.00
R3713:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3760:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3771:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3772:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3773:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3916:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3917:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4117:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4260:Cd109 UTSW 9 78636463 missense possibly damaging 0.67
R4387:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4389:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4526:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4527:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4528:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4700:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4708:Cd109 UTSW 9 78672589 missense probably benign 0.00
R4723:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4750:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4751:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4754:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4755:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4773:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4984:Cd109 UTSW 9 78634677 critical splice donor site probably null
R5259:Cd109 UTSW 9 78710152 missense probably benign 0.30
R5353:Cd109 UTSW 9 78710239 missense probably damaging 1.00
R5440:Cd109 UTSW 9 78680164 critical splice donor site probably null
R5559:Cd109 UTSW 9 78660968 missense probably benign 0.01
R5701:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R5995:Cd109 UTSW 9 78700279 missense probably benign 0.01
R5997:Cd109 UTSW 9 78705062 missense possibly damaging 0.93
R6103:Cd109 UTSW 9 78698314 splice site probably null
R6174:Cd109 UTSW 9 78665546 critical splice donor site probably null
R6410:Cd109 UTSW 9 78657516 missense probably benign 0.01
R6529:Cd109 UTSW 9 78712625 missense probably damaging 1.00
R6655:Cd109 UTSW 9 78684938 missense probably benign 0.44
R6704:Cd109 UTSW 9 78680075 missense probably benign 0.01
R6772:Cd109 UTSW 9 78680810 missense possibly damaging 0.55
R6817:Cd109 UTSW 9 78714955 missense probably benign 0.01
R6903:Cd109 UTSW 9 78636603 missense probably damaging 0.97
R7294:Cd109 UTSW 9 78712635 missense probably damaging 0.97
R7432:Cd109 UTSW 9 78714943 missense possibly damaging 0.85
R7566:Cd109 UTSW 9 78680837 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCCTTTAGTAGACGGGGAC -3'
(R):5'- TGCCTGCCTTGATTCCCAAAG -3'

Sequencing Primer
(F):5'- GGGGACTAAGAACCATTCCTCTG -3'
(R):5'- GCCTTGATTCCCAAAGTCTTAGAAAC -3'
Posted On2015-03-18