Incidental Mutation 'R3762:Plscr2'
ID270564
Institutional Source Beutler Lab
Gene Symbol Plscr2
Ensembl Gene ENSMUSG00000032372
Gene Namephospholipid scramblase 2
SynonymsPL scramblase
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3762 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location92275602-92297752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92291080 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 90 (V90D)
Ref Sequence ENSEMBL: ENSMUSP00000108667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034932] [ENSMUST00000113044] [ENSMUST00000180154]
Predicted Effect probably damaging
Transcript: ENSMUST00000034932
AA Change: V225D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034932
Gene: ENSMUSG00000032372
AA Change: V225D

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
Pfam:Scramblase 84 305 5.1e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113044
AA Change: V90D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108667
Gene: ENSMUSG00000032372
AA Change: V90D

DomainStartEndE-ValueType
Pfam:Scramblase 1 170 5.8e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156772
Predicted Effect probably damaging
Transcript: ENSMUST00000180154
AA Change: V225D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136481
Gene: ENSMUSG00000032372
AA Change: V225D

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
Pfam:Scramblase 84 305 5.1e-94 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A T 7: 16,565,075 S22T probably damaging Het
Atp2b1 T C 10: 99,009,489 I718T probably damaging Het
Cad T A 5: 31,075,546 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Dnah17 T A 11: 118,104,526 M999L probably benign Het
Dpysl4 A G 7: 139,096,756 E374G probably damaging Het
Gatad2a T C 8: 69,916,280 probably null Het
Gm15293 C T 8: 21,201,737 S45F probably damaging Het
Gm826 C A 2: 160,313,503 probably benign Het
H2-M10.1 T A 17: 36,325,324 H117L probably damaging Het
Klhl9 A T 4: 88,721,593 V137D possibly damaging Het
Limch1 A G 5: 67,028,840 Y828C probably damaging Het
Med1 T C 11: 98,155,515 probably benign Het
Muc5ac A T 7: 141,807,475 T1507S possibly damaging Het
Pak6 A T 2: 118,696,477 Q651L probably damaging Het
Rbbp4 G A 4: 129,334,551 T2I probably damaging Het
Rnf121 G A 7: 102,024,037 T223M probably damaging Het
Rsph6a A G 7: 19,055,331 K196R probably damaging Het
Tex47 A T 5: 7,305,529 I237L probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r30 C A 6: 58,435,293 V185L probably benign Het
Vmn2r103 A T 17: 19,812,149 E728D probably damaging Het
Vmn2r14 A T 5: 109,220,167 Y320N probably benign Het
Zc3h14 T A 12: 98,758,643 F188Y probably damaging Het
Other mutations in Plscr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Plscr2 APN 9 92290632 splice site probably benign
IGL02496:Plscr2 APN 9 92289663 missense probably benign 0.12
R0401:Plscr2 UTSW 9 92282135 missense probably benign
R0620:Plscr2 UTSW 9 92287654 missense probably benign 0.10
R0879:Plscr2 UTSW 9 92287793 missense probably damaging 1.00
R1829:Plscr2 UTSW 9 92290755 missense probably damaging 1.00
R2022:Plscr2 UTSW 9 92295594 missense probably damaging 1.00
R2237:Plscr2 UTSW 9 92290824 missense probably damaging 1.00
R2971:Plscr2 UTSW 9 92290671 nonsense probably null
R3552:Plscr2 UTSW 9 92290795 missense probably damaging 1.00
R4214:Plscr2 UTSW 9 92287737 missense probably benign 0.09
R4528:Plscr2 UTSW 9 92289693 missense possibly damaging 0.87
R4679:Plscr2 UTSW 9 92287770 missense probably benign 0.13
R4708:Plscr2 UTSW 9 92291014 missense probably damaging 1.00
R4709:Plscr2 UTSW 9 92291014 missense probably damaging 1.00
R4831:Plscr2 UTSW 9 92291077 missense possibly damaging 0.89
R5244:Plscr2 UTSW 9 92291049 missense probably benign 0.33
R6102:Plscr2 UTSW 9 92287668 missense probably benign 0.32
R6298:Plscr2 UTSW 9 92290719 missense probably benign 0.05
R6893:Plscr2 UTSW 9 92290704 missense probably benign 0.05
R7320:Plscr2 UTSW 9 92291140 critical splice donor site probably null
R7876:Plscr2 UTSW 9 92287728 missense probably benign
R8220:Plscr2 UTSW 9 92295660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTGTGAAGTAACCATAGCAGC -3'
(R):5'- GAACATTTGCAAGGTGGGTAC -3'

Sequencing Primer
(F):5'- AGTAACCATAGCAGCTTGAAAAG -3'
(R):5'- GTGGGTACACATCCAGTCAC -3'
Posted On2015-03-18