Incidental Mutation 'R3762:Atp2b1'
ID270565
Institutional Source Beutler Lab
Gene Symbol Atp2b1
Ensembl Gene ENSMUSG00000019943
Gene NameATPase, Ca++ transporting, plasma membrane 1
SynonymsPMCA1, 2810442I22Rik, E130111D10Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3762 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location98914406-99026143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99009489 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 718 (I718T)
Ref Sequence ENSEMBL: ENSMUSP00000020107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020107]
Predicted Effect probably damaging
Transcript: ENSMUST00000020107
AA Change: I718T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020107
Gene: ENSMUSG00000019943
AA Change: I718T

DomainStartEndE-ValueType
Cation_ATPase_N 50 126 1.8e-3 SMART
low complexity region 138 156 N/A INTRINSIC
Pfam:E1-E2_ATPase 157 312 1.5e-28 PFAM
Pfam:E1-E2_ATPase 348 464 1.4e-13 PFAM
Pfam:HAD 472 806 6.9e-22 PFAM
Pfam:Cation_ATPase 492 614 8.8e-17 PFAM
Pfam:Hydrolase 605 809 5.8e-14 PFAM
Pfam:Hydrolase_3 764 842 7.2e-7 PFAM
transmembrane domain 855 877 N/A INTRINSIC
Pfam:Cation_ATPase_C 879 1061 1.2e-47 PFAM
low complexity region 1079 1092 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1103 1155 7.5e-31 PFAM
low complexity region 1176 1188 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000219090
AA Change: I137T
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 1. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A T 7: 16,565,075 S22T probably damaging Het
Cad T A 5: 31,075,546 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Dnah17 T A 11: 118,104,526 M999L probably benign Het
Dpysl4 A G 7: 139,096,756 E374G probably damaging Het
Gatad2a T C 8: 69,916,280 probably null Het
Gm15293 C T 8: 21,201,737 S45F probably damaging Het
Gm826 C A 2: 160,313,503 probably benign Het
H2-M10.1 T A 17: 36,325,324 H117L probably damaging Het
Klhl9 A T 4: 88,721,593 V137D possibly damaging Het
Limch1 A G 5: 67,028,840 Y828C probably damaging Het
Med1 T C 11: 98,155,515 probably benign Het
Muc5ac A T 7: 141,807,475 T1507S possibly damaging Het
Pak6 A T 2: 118,696,477 Q651L probably damaging Het
Plscr2 T A 9: 92,291,080 V90D probably damaging Het
Rbbp4 G A 4: 129,334,551 T2I probably damaging Het
Rnf121 G A 7: 102,024,037 T223M probably damaging Het
Rsph6a A G 7: 19,055,331 K196R probably damaging Het
Tex47 A T 5: 7,305,529 I237L probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r30 C A 6: 58,435,293 V185L probably benign Het
Vmn2r103 A T 17: 19,812,149 E728D probably damaging Het
Vmn2r14 A T 5: 109,220,167 Y320N probably benign Het
Zc3h14 T A 12: 98,758,643 F188Y probably damaging Het
Other mutations in Atp2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Atp2b1 APN 10 99015020 missense possibly damaging 0.84
IGL00972:Atp2b1 APN 10 99015044 missense probably damaging 1.00
IGL00977:Atp2b1 APN 10 98986975 missense possibly damaging 0.88
IGL01154:Atp2b1 APN 10 98996888 missense probably damaging 1.00
IGL03073:Atp2b1 APN 10 98999851 missense probably damaging 1.00
IGL03081:Atp2b1 APN 10 98994813 splice site probably benign
PIT4453001:Atp2b1 UTSW 10 99016978 missense probably benign 0.00
R0157:Atp2b1 UTSW 10 98999947 missense probably damaging 0.99
R0200:Atp2b1 UTSW 10 98979814 nonsense probably null
R0899:Atp2b1 UTSW 10 99017031 critical splice donor site probably null
R0981:Atp2b1 UTSW 10 99015629 missense probably damaging 1.00
R1163:Atp2b1 UTSW 10 98979851 missense possibly damaging 0.91
R1569:Atp2b1 UTSW 10 98987326 missense probably benign 0.02
R1572:Atp2b1 UTSW 10 98994675 missense probably benign 0.10
R1574:Atp2b1 UTSW 10 98996948 missense probably damaging 1.00
R1574:Atp2b1 UTSW 10 98996948 missense probably damaging 1.00
R1721:Atp2b1 UTSW 10 98996888 missense probably damaging 1.00
R1782:Atp2b1 UTSW 10 99003201 missense probably benign 0.01
R1840:Atp2b1 UTSW 10 99022929 missense probably benign 0.00
R1867:Atp2b1 UTSW 10 98996888 missense probably damaging 1.00
R1868:Atp2b1 UTSW 10 98996888 missense probably damaging 1.00
R1944:Atp2b1 UTSW 10 99022931 missense probably damaging 0.97
R1984:Atp2b1 UTSW 10 99014492 missense possibly damaging 0.95
R2055:Atp2b1 UTSW 10 99014559 missense probably damaging 1.00
R2325:Atp2b1 UTSW 10 99018895 nonsense probably null
R2399:Atp2b1 UTSW 10 98999923 missense probably benign 0.02
R2876:Atp2b1 UTSW 10 98999745 missense probably damaging 0.96
R3776:Atp2b1 UTSW 10 98979869 frame shift probably null
R3808:Atp2b1 UTSW 10 99003148 missense possibly damaging 0.74
R3978:Atp2b1 UTSW 10 98996933 unclassified probably null
R4391:Atp2b1 UTSW 10 99003214 missense probably benign 0.00
R4825:Atp2b1 UTSW 10 99009564 missense probably damaging 1.00
R5755:Atp2b1 UTSW 10 99003170 missense probably damaging 1.00
R5755:Atp2b1 UTSW 10 98994809 critical splice donor site probably null
R6018:Atp2b1 UTSW 10 99010760 missense probably damaging 1.00
R6179:Atp2b1 UTSW 10 99022829 missense probably damaging 1.00
R6455:Atp2b1 UTSW 10 99016980 missense possibly damaging 0.76
R6496:Atp2b1 UTSW 10 99003337 missense probably damaging 0.98
R6786:Atp2b1 UTSW 10 99016959 missense probably damaging 1.00
R6814:Atp2b1 UTSW 10 99023015 missense possibly damaging 0.87
R7034:Atp2b1 UTSW 10 98987310 missense probably damaging 1.00
R7036:Atp2b1 UTSW 10 98987310 missense probably damaging 1.00
R7079:Atp2b1 UTSW 10 99018733 missense probably benign 0.01
R7216:Atp2b1 UTSW 10 98986977 missense probably benign 0.30
R7510:Atp2b1 UTSW 10 98993896 missense probably benign 0.01
R7562:Atp2b1 UTSW 10 99022805 splice site probably null
R7651:Atp2b1 UTSW 10 99016968 missense probably damaging 0.99
R7739:Atp2b1 UTSW 10 99001365 missense probably benign 0.01
R8005:Atp2b1 UTSW 10 98994799 missense probably damaging 1.00
R8111:Atp2b1 UTSW 10 98996924 missense possibly damaging 0.95
Z1177:Atp2b1 UTSW 10 99018848 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGACATCTTGAGATCAATGTGTC -3'
(R):5'- GAGGCATGGACCCTAACAAC -3'

Sequencing Primer
(F):5'- CATCTTGAGATCAATGTGTCAGTTG -3'
(R):5'- GAGGCATGGACCCTAACAACAAATG -3'
Posted On2015-03-18