Incidental Mutation 'R3763:Acvr2a'
ID270578
Institutional Source Beutler Lab
Gene Symbol Acvr2a
Ensembl Gene ENSMUSG00000052155
Gene Nameactivin receptor IIA
SynonymsActRIIa, Acvr2, tActRII
MMRRC Submission 040873-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3763 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location48814109-48903269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48870319 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 29 (E29G)
Ref Sequence ENSEMBL: ENSMUSP00000067305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063886]
PDB Structure
CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF THE TYPE II ACTIVIN RECEPTOR [X-RAY DIFFRACTION]
Crystal Structure of the BMP7/ActRII Extracellular Domain Complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063886
AA Change: E29G

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000067305
Gene: ENSMUSG00000052155
AA Change: E29G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Activin_recp 28 118 5e-10 PFAM
transmembrane domain 139 161 N/A INTRINSIC
Pfam:Pkinase_Tyr 192 479 1.2e-31 PFAM
Pfam:Pkinase 196 481 7.6e-34 PFAM
low complexity region 486 502 N/A INTRINSIC
Meta Mutation Damage Score 0.2009 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor that mediates the functions of activins, which are members of the transforming growth factor-beta (TGF-beta) superfamily involved in diverse biological processes. The encoded protein is a transmembrane serine-threonine kinase receptor which mediates signaling by forming heterodimeric complexes with various combinations of type I and type II receptors and ligands in a cell-specific manner. The encoded type II receptor is primarily involved in ligand-binding and includes an extracellular ligand-binding domain, a transmembrane domain and a cytoplasmic serine-threonine kinase domain. This gene may be associated with susceptibility to preeclampsia, a pregnancy-related disease which can result in maternal and fetal morbidity and mortality. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: While most mice homozygous for targeted mutations that inactivate this gene appear normal, a few display skeletal and facial abnormalities. As adults, follicle-stimulating hormone is suppressed, affecting reproduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 A G 1: 38,252,689 probably benign Het
AW146154 A G 7: 41,480,370 C441R probably damaging Het
Cacna1a T C 8: 84,583,642 V1443A possibly damaging Het
Commd1 T A 11: 22,974,102 F292Y probably benign Het
Ddx18 A G 1: 121,561,377 Y314H probably damaging Het
Dna2 C T 10: 62,966,797 T898I probably damaging Het
Epc1 C A 18: 6,440,091 V59L possibly damaging Het
Etv6 C A 6: 134,263,012 probably benign Het
Fam118a A G 15: 85,053,797 D293G possibly damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gzmn A C 14: 56,166,904 S159A probably benign Het
Insc A G 7: 114,790,972 D26G probably damaging Het
L1td1 A G 4: 98,737,835 R756G probably damaging Het
Ltk A G 2: 119,751,837 L499P probably benign Het
Mast4 A T 13: 102,787,419 L291M probably damaging Het
Nefm G T 14: 68,124,348 R156S probably damaging Het
Nppc T A 1: 86,669,858 N63Y probably damaging Het
Olfr507 A T 7: 108,622,717 I302F probably damaging Het
Olfr816 A G 10: 129,911,445 S278P probably damaging Het
Pcdhb7 T C 18: 37,341,883 V24A probably benign Het
Pcm1 C A 8: 41,280,077 Q787K probably damaging Het
Prg3 A G 2: 84,992,990 K170E possibly damaging Het
Slc25a54 T C 3: 109,112,054 S325P probably damaging Het
Slc44a1 T C 4: 53,563,286 V671A probably benign Het
Spock3 T A 8: 63,144,015 probably null Het
Stk-ps2 G A 1: 46,029,921 noncoding transcript Het
Svep1 T G 4: 58,084,833 D1835A possibly damaging Het
Tmcc3 A G 10: 94,579,317 T294A probably benign Het
Tsen54 A G 11: 115,820,411 N62S probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r18 G A 5: 151,585,179 A160V probably damaging Het
Wnk4 T C 11: 101,269,288 V661A probably benign Het
Zfhx4 A G 3: 5,403,344 Y2854C probably damaging Het
Zfp563 G T 17: 33,104,928 E166* probably null Het
Zfp687 T A 3: 95,012,080 N127I probably damaging Het
Zfp958 T A 8: 4,626,226 probably null Het
Other mutations in Acvr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Acvr2a APN 2 48873052 splice site probably benign
IGL01551:Acvr2a APN 2 48897059 missense probably damaging 1.00
IGL01913:Acvr2a APN 2 48899613 missense probably damaging 1.00
IGL02100:Acvr2a APN 2 48898618 splice site probably benign
IGL02210:Acvr2a APN 2 48898526 missense probably damaging 0.99
R0864:Acvr2a UTSW 2 48894786 splice site probably benign
R1371:Acvr2a UTSW 2 48899616 missense probably damaging 1.00
R1676:Acvr2a UTSW 2 48873083 missense probably benign 0.00
R2196:Acvr2a UTSW 2 48870312 missense possibly damaging 0.94
R2876:Acvr2a UTSW 2 48892178 missense probably damaging 1.00
R3721:Acvr2a UTSW 2 48892138 missense probably damaging 1.00
R4401:Acvr2a UTSW 2 48899702 missense probably benign
R4724:Acvr2a UTSW 2 48870435 missense probably damaging 1.00
R4921:Acvr2a UTSW 2 48893541 missense possibly damaging 0.51
R5060:Acvr2a UTSW 2 48890299 missense probably damaging 0.96
R5347:Acvr2a UTSW 2 48892154 missense probably damaging 1.00
R5953:Acvr2a UTSW 2 48890404 missense probably damaging 1.00
R6892:Acvr2a UTSW 2 48897075 missense probably damaging 1.00
R7594:Acvr2a UTSW 2 48894737 nonsense probably null
R7876:Acvr2a UTSW 2 48870427 missense probably benign 0.01
R7959:Acvr2a UTSW 2 48870427 missense probably benign 0.01
Z1088:Acvr2a UTSW 2 48870373 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTAAAGCATGGCCATTCAAATGC -3'
(R):5'- AGAAGGAAAGTCACTGAACTCC -3'

Sequencing Primer
(F):5'- GCATGGCCATTCAAATGCAAAGTTG -3'
(R):5'- ACATTCTTACCTGTCATAGCAGTTG -3'
Posted On2015-03-18