Incidental Mutation 'R3763:Etv6'
ID 270590
Institutional Source Beutler Lab
Gene Symbol Etv6
Ensembl Gene ENSMUSG00000030199
Gene Name ets variant 6
Synonyms translocation-ets-leukemia, Tel
MMRRC Submission 040873-MU
Accession Numbers

Ncbi RefSeq: NM_007961.3; MGI: 109336
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3763 (G1)
Quality Score 136
Status Validated
Chromosome 6
Chromosomal Location 134035700-134270158 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 134263012 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081028] [ENSMUST00000111963]
AlphaFold P97360
Predicted Effect probably benign
Transcript: ENSMUST00000081028
SMART Domains Protein: ENSMUSP00000079818
Gene: ENSMUSG00000030199

DomainStartEndE-ValueType
SAM_PNT 39 125 3.49e-41 SMART
ETS 334 420 7.02e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111963
SMART Domains Protein: ENSMUSP00000107594
Gene: ENSMUSG00000030199

DomainStartEndE-ValueType
Pfam:SAM_PNT 1 36 1.3e-10 PFAM
ETS 245 331 7.02e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169529
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (37/37)
MGI Phenotype Strain: 2177950; 3056143
Lethality: E11-E14
FUNCTION: This gene encodes a transcriptional repressor belonging to the ETS family of proteins. Knockout of this gene in mice results in embryonic lethality due to defective angiogenesis. In humans, this gene is often involved in chromosome rearrangements associated with specific cancers. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defective yolk sac angiogenesis, excess apoptosis of mesenchymal and neural cells, and midgestational lethality. [provided by MGI curators]
Allele List at MGI

All alleles(134) : Targeted(7) Gene trapped(127)
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,870,319 E29G possibly damaging Het
Aff3 A G 1: 38,252,689 probably benign Het
AW146154 A G 7: 41,480,370 C441R probably damaging Het
Cacna1a T C 8: 84,583,642 V1443A possibly damaging Het
Commd1 T A 11: 22,974,102 F292Y probably benign Het
Ddx18 A G 1: 121,561,377 Y314H probably damaging Het
Dna2 C T 10: 62,966,797 T898I probably damaging Het
Epc1 C A 18: 6,440,091 V59L possibly damaging Het
Fam118a A G 15: 85,053,797 D293G possibly damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gzmn A C 14: 56,166,904 S159A probably benign Het
Insc A G 7: 114,790,972 D26G probably damaging Het
L1td1 A G 4: 98,737,835 R756G probably damaging Het
Ltk A G 2: 119,751,837 L499P probably benign Het
Mast4 A T 13: 102,787,419 L291M probably damaging Het
Nefm G T 14: 68,124,348 R156S probably damaging Het
Nppc T A 1: 86,669,858 N63Y probably damaging Het
Olfr507 A T 7: 108,622,717 I302F probably damaging Het
Olfr816 A G 10: 129,911,445 S278P probably damaging Het
Pcdhb7 T C 18: 37,341,883 V24A probably benign Het
Pcm1 C A 8: 41,280,077 Q787K probably damaging Het
Prg3 A G 2: 84,992,990 K170E possibly damaging Het
Slc25a54 T C 3: 109,112,054 S325P probably damaging Het
Slc44a1 T C 4: 53,563,286 V671A probably benign Het
Spock3 T A 8: 63,144,015 probably null Het
Stk-ps2 G A 1: 46,029,921 noncoding transcript Het
Svep1 T G 4: 58,084,833 D1835A possibly damaging Het
Tmcc3 A G 10: 94,579,317 T294A probably benign Het
Tsen54 A G 11: 115,820,411 N62S probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r18 G A 5: 151,585,179 A160V probably damaging Het
Wnk4 T C 11: 101,269,288 V661A probably benign Het
Zfhx4 A G 3: 5,403,344 Y2854C probably damaging Het
Zfp563 G T 17: 33,104,928 E166* probably null Het
Zfp687 T A 3: 95,012,080 N127I probably damaging Het
Zfp958 T A 8: 4,626,226 probably null Het
Other mutations in Etv6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Etv6 APN 6 134248387 missense probably benign 0.41
IGL02028:Etv6 APN 6 134248733 missense probably benign 0.01
IGL02173:Etv6 APN 6 134248727 missense possibly damaging 0.68
IGL03074:Etv6 APN 6 134222925 missense probably damaging 0.98
R0056:Etv6 UTSW 6 134248534 nonsense probably null
R0295:Etv6 UTSW 6 134266275 missense probably benign 0.31
R2133:Etv6 UTSW 6 134248754 missense possibly damaging 0.92
R4405:Etv6 UTSW 6 134233534 missense probably damaging 1.00
R6901:Etv6 UTSW 6 134266458 missense probably benign 0.10
R8292:Etv6 UTSW 6 134248546 missense probably benign
R8343:Etv6 UTSW 6 134248754 missense possibly damaging 0.92
R8752:Etv6 UTSW 6 134266428 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTAGGAGGAGACCTTGGCCAC -3'
(R):5'- AGATTGGCATGTCAGAGCTC -3'

Sequencing Primer
(F):5'- AGACCTTGGCCACAGTGG -3'
(R):5'- AGAGCTCCTCCCTCTTCTGTAAAG -3'
Posted On 2015-03-18