Incidental Mutation 'R3763:Pcm1'
ID270595
Institutional Source Beutler Lab
Gene Symbol Pcm1
Ensembl Gene ENSMUSG00000031592
Gene Namepericentriolar material 1
Synonyms9430077F19Rik, 2600002H09Rik, C030044G17Rik
MMRRC Submission 040873-MU
Accession Numbers

Genbank: NM_023662; MGI: 1277958

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3763 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location41239752-41332344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 41280077 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 787 (Q787K)
Ref Sequence ENSEMBL: ENSMUSP00000147887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045218] [ENSMUST00000211247]
Predicted Effect probably damaging
Transcript: ENSMUST00000045218
AA Change: Q748K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039709
Gene: ENSMUSG00000031592
AA Change: Q748K

DomainStartEndE-ValueType
coiled coil region 218 238 N/A INTRINSIC
coiled coil region 270 301 N/A INTRINSIC
coiled coil region 399 426 N/A INTRINSIC
coiled coil region 492 520 N/A INTRINSIC
low complexity region 527 548 N/A INTRINSIC
low complexity region 622 647 N/A INTRINSIC
coiled coil region 652 683 N/A INTRINSIC
coiled coil region 724 772 N/A INTRINSIC
coiled coil region 822 856 N/A INTRINSIC
coiled coil region 988 1017 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
low complexity region 1287 1301 N/A INTRINSIC
Pfam:PCM1_C 1369 1999 3.6e-295 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211090
Predicted Effect probably damaging
Transcript: ENSMUST00000211247
AA Change: Q787K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.0856 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of centriolar satellites, which are electron dense granules scattered around centrosomes. Inhibition studies show that this protein is essential for the correct localization of several centrosomal proteins, and for anchoring microtubules to the centrosome. Chromosomal aberrations involving this gene are associated with papillary thyroid carcinomas and a variety of hematological malignancies, including atypical chronic myeloid leukemia and T-cell lymphoma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,870,319 E29G possibly damaging Het
Aff3 A G 1: 38,252,689 probably benign Het
AW146154 A G 7: 41,480,370 C441R probably damaging Het
Cacna1a T C 8: 84,583,642 V1443A possibly damaging Het
Commd1 T A 11: 22,974,102 F292Y probably benign Het
Ddx18 A G 1: 121,561,377 Y314H probably damaging Het
Dna2 C T 10: 62,966,797 T898I probably damaging Het
Epc1 C A 18: 6,440,091 V59L possibly damaging Het
Etv6 C A 6: 134,263,012 probably benign Het
Fam118a A G 15: 85,053,797 D293G possibly damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gzmn A C 14: 56,166,904 S159A probably benign Het
Insc A G 7: 114,790,972 D26G probably damaging Het
L1td1 A G 4: 98,737,835 R756G probably damaging Het
Ltk A G 2: 119,751,837 L499P probably benign Het
Mast4 A T 13: 102,787,419 L291M probably damaging Het
Nefm G T 14: 68,124,348 R156S probably damaging Het
Nppc T A 1: 86,669,858 N63Y probably damaging Het
Olfr507 A T 7: 108,622,717 I302F probably damaging Het
Olfr816 A G 10: 129,911,445 S278P probably damaging Het
Pcdhb7 T C 18: 37,341,883 V24A probably benign Het
Prg3 A G 2: 84,992,990 K170E possibly damaging Het
Slc25a54 T C 3: 109,112,054 S325P probably damaging Het
Slc44a1 T C 4: 53,563,286 V671A probably benign Het
Spock3 T A 8: 63,144,015 probably null Het
Stk-ps2 G A 1: 46,029,921 noncoding transcript Het
Svep1 T G 4: 58,084,833 D1835A possibly damaging Het
Tmcc3 A G 10: 94,579,317 T294A probably benign Het
Tsen54 A G 11: 115,820,411 N62S probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r18 G A 5: 151,585,179 A160V probably damaging Het
Wnk4 T C 11: 101,269,288 V661A probably benign Het
Zfhx4 A G 3: 5,403,344 Y2854C probably damaging Het
Zfp563 G T 17: 33,104,928 E166* probably null Het
Zfp687 T A 3: 95,012,080 N127I probably damaging Het
Zfp958 T A 8: 4,626,226 probably null Het
Other mutations in Pcm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Pcm1 APN 8 41274277 missense probably damaging 1.00
IGL00852:Pcm1 APN 8 41287821 missense probably damaging 1.00
IGL00896:Pcm1 APN 8 41276123 missense possibly damaging 0.70
IGL00927:Pcm1 APN 8 41287881 missense probably damaging 1.00
IGL01085:Pcm1 APN 8 41309603 missense probably damaging 1.00
IGL01684:Pcm1 APN 8 41257923 missense probably benign 0.00
IGL01888:Pcm1 APN 8 41257956 missense probably damaging 0.98
IGL02349:Pcm1 APN 8 41288155 critical splice donor site probably null
IGL02562:Pcm1 APN 8 41325368 missense probably damaging 1.00
IGL02807:Pcm1 APN 8 41330882 missense probably damaging 1.00
IGL03081:Pcm1 APN 8 41275060 missense probably damaging 1.00
shaved UTSW 8 41288156 critical splice donor site probably null
D3080:Pcm1 UTSW 8 41275939 missense probably damaging 1.00
P0045:Pcm1 UTSW 8 41288097 missense probably damaging 0.99
R0090:Pcm1 UTSW 8 41256041 missense probably damaging 0.99
R0109:Pcm1 UTSW 8 41257937 missense possibly damaging 0.88
R0373:Pcm1 UTSW 8 41276111 nonsense probably null
R0386:Pcm1 UTSW 8 41316023 missense probably damaging 1.00
R0452:Pcm1 UTSW 8 41325905 missense probably benign 0.25
R0498:Pcm1 UTSW 8 41293769 missense probably benign 0.01
R0528:Pcm1 UTSW 8 41315930 missense probably damaging 1.00
R0587:Pcm1 UTSW 8 41286051 missense probably damaging 0.99
R0635:Pcm1 UTSW 8 41267179 splice site probably benign
R0725:Pcm1 UTSW 8 41287811 missense probably damaging 1.00
R0762:Pcm1 UTSW 8 41261020 missense probably damaging 1.00
R0848:Pcm1 UTSW 8 41282683 missense probably damaging 1.00
R1027:Pcm1 UTSW 8 41293445 splice site probably benign
R1056:Pcm1 UTSW 8 41321900 missense probably damaging 1.00
R1534:Pcm1 UTSW 8 41287701 missense probably benign
R1566:Pcm1 UTSW 8 41290773 missense probably damaging 1.00
R1595:Pcm1 UTSW 8 41309635 missense probably damaging 1.00
R1719:Pcm1 UTSW 8 41313359 missense possibly damaging 0.62
R1816:Pcm1 UTSW 8 41309537 missense probably damaging 0.99
R2177:Pcm1 UTSW 8 41275965 missense probably benign
R2495:Pcm1 UTSW 8 41293579 missense probably benign
R3737:Pcm1 UTSW 8 41261043 nonsense probably null
R3747:Pcm1 UTSW 8 41332004 missense probably benign 0.44
R3764:Pcm1 UTSW 8 41330882 missense probably damaging 1.00
R3798:Pcm1 UTSW 8 41258014 missense possibly damaging 0.66
R3968:Pcm1 UTSW 8 41325830 missense probably damaging 1.00
R4760:Pcm1 UTSW 8 41287738 missense probably damaging 0.99
R4798:Pcm1 UTSW 8 41293678 missense probably damaging 1.00
R5062:Pcm1 UTSW 8 41259260 missense probably damaging 0.99
R5221:Pcm1 UTSW 8 41288156 critical splice donor site probably null
R5250:Pcm1 UTSW 8 41312205 missense probably damaging 0.99
R5466:Pcm1 UTSW 8 41272462 critical splice donor site probably null
R5470:Pcm1 UTSW 8 41287683 missense probably damaging 1.00
R5958:Pcm1 UTSW 8 41328979 missense probably damaging 1.00
R6043:Pcm1 UTSW 8 41328778 missense possibly damaging 0.54
R6179:Pcm1 UTSW 8 41283632 missense probably damaging 0.99
R6186:Pcm1 UTSW 8 41293793 missense probably benign 0.23
R6227:Pcm1 UTSW 8 41330825 missense probably damaging 0.99
R6368:Pcm1 UTSW 8 41293544 missense probably benign 0.09
R6438:Pcm1 UTSW 8 41325381 missense possibly damaging 0.94
R6459:Pcm1 UTSW 8 41261036 missense probably damaging 1.00
R7399:Pcm1 UTSW 8 41293510 missense probably benign 0.11
R7401:Pcm1 UTSW 8 41309531 missense probably damaging 1.00
R7478:Pcm1 UTSW 8 41261373 missense probably benign 0.17
R7570:Pcm1 UTSW 8 41267344 missense possibly damaging 0.64
R7648:Pcm1 UTSW 8 41275699 missense probably damaging 0.99
R7773:Pcm1 UTSW 8 41309573 nonsense probably null
R7779:Pcm1 UTSW 8 41329024 missense probably damaging 1.00
X0025:Pcm1 UTSW 8 41330642 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATGATTTCTATGCAGCAGAAGAAG -3'
(R):5'- GCCATCTAATGACCAGTAAAGC -3'

Sequencing Primer
(F):5'- TTTCTATGCAGCAGAAGAAGATATC -3'
(R):5'- TGACCAGTAAAGCCAGACTAGTTC -3'
Posted On2015-03-18