Incidental Mutation 'R3763:Olfr816'
ID270601
Institutional Source Beutler Lab
Gene Symbol Olfr816
Ensembl Gene ENSMUSG00000063715
Gene Nameolfactory receptor 816
SynonymsGA_x6K02T2PULF-11590830-11589892, MOR113-1
MMRRC Submission 040873-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3763 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129909163-129915597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129911445 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 278 (S278P)
Ref Sequence ENSEMBL: ENSMUSP00000149515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071605] [ENSMUST00000213438]
Predicted Effect probably damaging
Transcript: ENSMUST00000071605
AA Change: S278P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071534
Gene: ENSMUSG00000063715
AA Change: S278P

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6.9e-50 PFAM
Pfam:7tm_1 39 288 1.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213438
AA Change: S278P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213618
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,870,319 E29G possibly damaging Het
Aff3 A G 1: 38,252,689 probably benign Het
AW146154 A G 7: 41,480,370 C441R probably damaging Het
Cacna1a T C 8: 84,583,642 V1443A possibly damaging Het
Commd1 T A 11: 22,974,102 F292Y probably benign Het
Ddx18 A G 1: 121,561,377 Y314H probably damaging Het
Dna2 C T 10: 62,966,797 T898I probably damaging Het
Epc1 C A 18: 6,440,091 V59L possibly damaging Het
Etv6 C A 6: 134,263,012 probably benign Het
Fam118a A G 15: 85,053,797 D293G possibly damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gzmn A C 14: 56,166,904 S159A probably benign Het
Insc A G 7: 114,790,972 D26G probably damaging Het
L1td1 A G 4: 98,737,835 R756G probably damaging Het
Ltk A G 2: 119,751,837 L499P probably benign Het
Mast4 A T 13: 102,787,419 L291M probably damaging Het
Nefm G T 14: 68,124,348 R156S probably damaging Het
Nppc T A 1: 86,669,858 N63Y probably damaging Het
Olfr507 A T 7: 108,622,717 I302F probably damaging Het
Pcdhb7 T C 18: 37,341,883 V24A probably benign Het
Pcm1 C A 8: 41,280,077 Q787K probably damaging Het
Prg3 A G 2: 84,992,990 K170E possibly damaging Het
Slc25a54 T C 3: 109,112,054 S325P probably damaging Het
Slc44a1 T C 4: 53,563,286 V671A probably benign Het
Spock3 T A 8: 63,144,015 probably null Het
Stk-ps2 G A 1: 46,029,921 noncoding transcript Het
Svep1 T G 4: 58,084,833 D1835A possibly damaging Het
Tmcc3 A G 10: 94,579,317 T294A probably benign Het
Tsen54 A G 11: 115,820,411 N62S probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r18 G A 5: 151,585,179 A160V probably damaging Het
Wnk4 T C 11: 101,269,288 V661A probably benign Het
Zfhx4 A G 3: 5,403,344 Y2854C probably damaging Het
Zfp563 G T 17: 33,104,928 E166* probably null Het
Zfp687 T A 3: 95,012,080 N127I probably damaging Het
Zfp958 T A 8: 4,626,226 probably null Het
Other mutations in Olfr816
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Olfr816 APN 10 129912245 missense possibly damaging 0.89
IGL01650:Olfr816 APN 10 129911681 missense probably benign 0.00
IGL01766:Olfr816 APN 10 129911780 missense probably damaging 1.00
IGL02738:Olfr816 APN 10 129911331 utr 3 prime probably benign
IGL02824:Olfr816 APN 10 129911696 missense probably damaging 1.00
R0401:Olfr816 UTSW 10 129911916 missense probably benign 0.18
R0688:Olfr816 UTSW 10 129911883 missense probably damaging 0.99
R1589:Olfr816 UTSW 10 129911681 missense probably benign 0.00
R1744:Olfr816 UTSW 10 129911393 missense probably damaging 1.00
R2049:Olfr816 UTSW 10 129912167 missense probably benign 0.30
R3952:Olfr816 UTSW 10 129911636 missense probably benign 0.00
R3971:Olfr816 UTSW 10 129911873 missense probably benign 0.01
R4557:Olfr816 UTSW 10 129911529 missense probably damaging 1.00
R5538:Olfr816 UTSW 10 129912002 missense probably benign 0.13
R6127:Olfr816 UTSW 10 129911415 missense probably damaging 1.00
R6227:Olfr816 UTSW 10 129911667 missense probably damaging 1.00
R6394:Olfr816 UTSW 10 129911920 missense probably damaging 1.00
R6707:Olfr816 UTSW 10 129911739 missense probably benign 0.02
R7257:Olfr816 UTSW 10 129912287 start gained probably benign
R7258:Olfr816 UTSW 10 129912287 start gained probably benign
R7260:Olfr816 UTSW 10 129912287 start gained probably benign
R7409:Olfr816 UTSW 10 129912251 missense possibly damaging 0.74
R7539:Olfr816 UTSW 10 129912063 missense probably damaging 1.00
X0019:Olfr816 UTSW 10 129912095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGGCTTGAAATGATGTATGGTC -3'
(R):5'- TGGTAATGGTGATCATATCCTACAC -3'

Sequencing Primer
(F):5'- GAACTCACTTTATAGACCAGGCTGG -3'
(R):5'- GGTGATCATATCCTACACCTACATTG -3'
Posted On2015-03-18