Incidental Mutation 'R3763:Zfp563'
ID270609
Institutional Source Beutler Lab
Gene Symbol Zfp563
Ensembl Gene ENSMUSG00000067424
Gene Namezinc finger protein 563
Synonymszinc finger protein, Zfp413
MMRRC Submission 040873-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3763 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33089310-33106203 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 33104928 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 166 (E166*)
Ref Sequence ENSEMBL: ENSMUSP00000121678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000131722] [ENSMUST00000140829]
Predicted Effect probably null
Transcript: ENSMUST00000131722
AA Change: E166*
SMART Domains Protein: ENSMUSP00000118809
Gene: ENSMUSG00000067424
AA Change: E166*

DomainStartEndE-ValueType
KRAB 4 61 5.45e-16 SMART
ZnF_C2H2 141 163 2.63e2 SMART
ZnF_C2H2 169 191 9.08e-4 SMART
ZnF_C2H2 197 219 9.88e-5 SMART
ZnF_C2H2 225 247 3.16e-3 SMART
ZnF_C2H2 253 275 5.81e-2 SMART
ZnF_C2H2 281 303 2.4e-3 SMART
ZnF_C2H2 309 331 1.82e-3 SMART
ZnF_C2H2 337 359 1.72e-4 SMART
ZnF_C2H2 365 387 4.54e-4 SMART
ZnF_C2H2 393 415 7.78e-3 SMART
ZnF_C2H2 421 443 3.63e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140829
AA Change: E166*
SMART Domains Protein: ENSMUSP00000121678
Gene: ENSMUSG00000067424
AA Change: E166*

DomainStartEndE-ValueType
KRAB 4 61 5.45e-16 SMART
ZnF_C2H2 141 163 2.63e2 SMART
ZnF_C2H2 169 191 9.08e-4 SMART
Pfam:zf-C2H2_4 197 209 9.4e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153072
SMART Domains Protein: ENSMUSP00000119142
Gene: ENSMUSG00000067424

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
KRAB 45 102 5.45e-16 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,870,319 E29G possibly damaging Het
Aff3 A G 1: 38,252,689 probably benign Het
AW146154 A G 7: 41,480,370 C441R probably damaging Het
Cacna1a T C 8: 84,583,642 V1443A possibly damaging Het
Commd1 T A 11: 22,974,102 F292Y probably benign Het
Ddx18 A G 1: 121,561,377 Y314H probably damaging Het
Dna2 C T 10: 62,966,797 T898I probably damaging Het
Epc1 C A 18: 6,440,091 V59L possibly damaging Het
Etv6 C A 6: 134,263,012 probably benign Het
Fam118a A G 15: 85,053,797 D293G possibly damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gzmn A C 14: 56,166,904 S159A probably benign Het
Insc A G 7: 114,790,972 D26G probably damaging Het
L1td1 A G 4: 98,737,835 R756G probably damaging Het
Ltk A G 2: 119,751,837 L499P probably benign Het
Mast4 A T 13: 102,787,419 L291M probably damaging Het
Nefm G T 14: 68,124,348 R156S probably damaging Het
Nppc T A 1: 86,669,858 N63Y probably damaging Het
Olfr507 A T 7: 108,622,717 I302F probably damaging Het
Olfr816 A G 10: 129,911,445 S278P probably damaging Het
Pcdhb7 T C 18: 37,341,883 V24A probably benign Het
Pcm1 C A 8: 41,280,077 Q787K probably damaging Het
Prg3 A G 2: 84,992,990 K170E possibly damaging Het
Slc25a54 T C 3: 109,112,054 S325P probably damaging Het
Slc44a1 T C 4: 53,563,286 V671A probably benign Het
Spock3 T A 8: 63,144,015 probably null Het
Stk-ps2 G A 1: 46,029,921 noncoding transcript Het
Svep1 T G 4: 58,084,833 D1835A possibly damaging Het
Tmcc3 A G 10: 94,579,317 T294A probably benign Het
Tsen54 A G 11: 115,820,411 N62S probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r18 G A 5: 151,585,179 A160V probably damaging Het
Wnk4 T C 11: 101,269,288 V661A probably benign Het
Zfhx4 A G 3: 5,403,344 Y2854C probably damaging Het
Zfp687 T A 3: 95,012,080 N127I probably damaging Het
Zfp958 T A 8: 4,626,226 probably null Het
Other mutations in Zfp563
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Zfp563 APN 17 33104626 missense probably damaging 1.00
IGL01981:Zfp563 APN 17 33105409 missense probably benign 0.16
IGL02407:Zfp563 APN 17 33104821 missense probably benign 0.00
IGL02662:Zfp563 APN 17 33102279 missense probably damaging 1.00
IGL03220:Zfp563 APN 17 33104687 missense probably benign 0.44
R0241:Zfp563 UTSW 17 33104685 missense possibly damaging 0.61
R0241:Zfp563 UTSW 17 33104685 missense possibly damaging 0.61
R0537:Zfp563 UTSW 17 33104685 missense possibly damaging 0.61
R0552:Zfp563 UTSW 17 33104685 missense possibly damaging 0.61
R1544:Zfp563 UTSW 17 33105213 missense probably benign 0.01
R3979:Zfp563 UTSW 17 33105727 missense probably benign 0.03
R4938:Zfp563 UTSW 17 33105709 missense probably damaging 1.00
R5280:Zfp563 UTSW 17 33104838 missense probably damaging 0.99
R5383:Zfp563 UTSW 17 33104707 missense probably benign
R5485:Zfp563 UTSW 17 33089566 unclassified probably benign
R5524:Zfp563 UTSW 17 33102541 critical splice acceptor site probably null
R5567:Zfp563 UTSW 17 33089457 unclassified probably benign
R5736:Zfp563 UTSW 17 33104986 missense possibly damaging 0.91
R5758:Zfp563 UTSW 17 33104920 missense probably damaging 1.00
R6034:Zfp563 UTSW 17 33104961 missense probably damaging 0.96
R6034:Zfp563 UTSW 17 33104961 missense probably damaging 0.96
R6532:Zfp563 UTSW 17 33105698 missense probably benign 0.21
RF007:Zfp563 UTSW 17 33105025 missense probably benign
X0023:Zfp563 UTSW 17 33105721 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAAGACATACTTATTGGTCTTCC -3'
(R):5'- TGGAAGTGAACTTTGACCAGTG -3'

Sequencing Primer
(F):5'- ATTGGTCTTCCACCCCTAAATATG -3'
(R):5'- GAACTTTGACCAGTGAAAGCTTTCCC -3'
Posted On2015-03-18